Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
EGFP–acVHH–PB Resource Report Resource Website |
RRID:Addgene_169685 | anti-caffeine nanobody | Synthetic | Kanamycin | PMID:33552855 | Backbone Size:4900; Vector Backbone:mEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:01 | 0 | ||
|
Equalizer-M plasmid with onboard mCherry cassette Resource Report Resource Website |
RRID:Addgene_169734 | tetR-P2A-eGFP-miR(FF4) target-miR(FF4) | Synthetic | Ampicillin | PMID:34226556 | Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid. | Backbone Marker:invitrogen; Backbone Size:8594; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | |
|
Equalizer-L plasmid with onboard mCherry cassette Resource Report Resource Website |
RRID:Addgene_169735 | miR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4) | Synthetic | Ampicillin | PMID:34226556 | Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid. | Backbone Marker:invitrogen; Backbone Size:8585; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:01 | 0 | |
|
Equalizer-M plasmid Resource Report Resource Website |
RRID:Addgene_169731 | tetR-P2A-eGFP-miR(FF4) target-miR(FF4) | Synthetic | Ampicillin | PMID:34226556 | Backbone Marker:Invitrogen; Backbone Size:6113; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | ||
|
Equalizer-L plasmid Resource Report Resource Website |
RRID:Addgene_169732 | miR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4) | Synthetic | Ampicillin | PMID:34226556 | Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid. | Backbone Marker:Invitrogen; Backbone Size:6104; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:01 | 0 | |
|
Equalizer-L episome Resource Report Resource Website |
RRID:Addgene_169738 | miR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4) | Synthetic | Ampicillin | PMID:34226556 | Please note the OriP sequence contains a deletion that is also found in Addgene plasmid (pCEP4-CXCR4) which was used as the backbone. | Backbone Marker:Invitrogen; Backbone Size:13287; Vector Backbone:pCEP4; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | |
|
pCAG-spCas9-N57 Resource Report Resource Website |
RRID:Addgene_169920 | SpCas9-N57 | Synthetic | Ampicillin | PMID:32986839 | Backbone Marker:Addgene # 52962; Vector Backbone:pCAG-spCas9; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | N57 is the PAI domain of SB100X | 2026-08-15 01:10:03 | 0 | |
|
pRGEN-CMV-10XGCN4-L1-dCjCas9 S-D Resource Report Resource Website |
RRID:Addgene_169912 | dCjCas9 | Synthetic | Ampicillin | PMID:33751124 | Backbone Marker:Addgene #89752; Vector Backbone:pRGEN-CMV-CjCas9; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | D8A, H559A in cjCas9 | 2026-08-15 01:10:02 | 0 | |
|
pgRNAkan-glpR Resource Report Resource Website |
RRID:Addgene_169873 | sgRNA towards glpR in Pseudomonas putida | Synthetic | Kanamycin | PMID:34175462 | Vector Backbone:pBBR1k-GFP; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:02 | 0 | ||
|
pLentiCRISPR V2 sgACO1_2 Resource Report Resource Website |
RRID:Addgene_169892 | sgRNA targeting ACO1 | Synthetic | Ampicillin | PMID:34039609 | Target: CCACTACCCCAACCTGGCGG | Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | |
|
pLentiCRISPR V2 sgIREB2_1 Resource Report Resource Website |
RRID:Addgene_169894 | sgRNA targeting IREB2 | Synthetic | Ampicillin | PMID:34039609 | Target: AATGCACCAAATCCTGGAGG | Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:03 | 0 | |
|
pAAV.hSynapsin1.OxLight1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_169792 | OxLight1 | Synthetic | Ampicillin | PMID:35145320 | Backbone Marker:Viral Vector Facility - University of Zurich; Backbone Size:4438; Vector Backbone:pAAV.hSynapsin1; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 1 | ||
|
PGK+ plasmid with onboard mCherry cassette Resource Report Resource Website |
RRID:Addgene_169745 | eGFP | Synthetic | Ampicillin | PMID:34226556 | Backbone Size:8535; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:01 | 0 | ||
|
Negative feedback (NF) plasmid Resource Report Resource Website |
RRID:Addgene_169747 | tetR-P2A-eGFP | Synthetic | Ampicillin | PMID:34226556 | Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid. | Backbone Marker:Invitrogen; Backbone Size:6113; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | |
|
RRRAA-pHG165c Resource Report Resource Website |
RRID:Addgene_170112 | RRRAA | Synthetic | Ampicillin | PMID:34369028 | Vector Backbone:pHG165c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:05 | 0 | ||
|
UUUUA-pHG165c Resource Report Resource Website |
RRID:Addgene_170107 | UUUUA | Synthetic | Ampicillin | PMID:34369028 | Vector Backbone:pHG165c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:05 | 0 | ||
|
MMMMA-pHG165c Resource Report Resource Website |
RRID:Addgene_170108 | MelR | Synthetic | Ampicillin | PMID:34369028 | Vector Backbone:pHG165c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:05 | 0 | ||
|
pET-PE2-His (IK1822) Resource Report Resource Website 1+ mentions |
RRID:Addgene_170103 | bpNLS-nSpCas9(H840A)-MMLVRT-bpNLS-6xHis | Synthetic | Kanamycin | PMID:33927418 | This is a bacterial codon-optimized SpCas9 (H840A) sequence within pET-28b backbone (Addgene #73018) fused to bipartite NLS, a 33-amino acid linker and the engineered M-MLV RT from the parental pCMV-PE2 plasmid (Addgene #132775). To this construct, a short GS linker and a 6xHis-tag are added to C terminus. | Backbone Size:5238; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin | Bacteria codon-optimized nSpCas9 (H840A) & M-MLV RT (D200N, T306K, W313F, T330P, L603W) | 2026-08-15 01:10:04 | 3 |
|
pGFP-PacI Resource Report Resource Website |
RRID:Addgene_170100 | deGFP | Synthetic | Ampicillin | PMID:34985758 | Backbone Size:2400; Vector Backbone:pBEST; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:04 | 0 | ||
|
pGFP-GTATT Resource Report Resource Website |
RRID:Addgene_170099 | deGFP | Synthetic | Ampicillin | PMID:34985758 | Backbone Size:2400; Vector Backbone:pBEST; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:04 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
