Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 80 showing 1581 ~ 1600 out of 30,421 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_169685

http://www.addgene.org/169685

Species: Synthetic
Genetic Insert: anti-caffeine nanobody
Vector Backbone Description: Backbone Size:4900; Vector Backbone:mEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33552855

Proper citation: RRID:Addgene_169685 Copy   


http://www.addgene.org/169734

Species: Synthetic
Genetic Insert: tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:8594; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556
Comments: Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid.

Proper citation: RRID:Addgene_169734 Copy   


http://www.addgene.org/169735

Species: Synthetic
Genetic Insert: miR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:8585; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556
Comments: Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid.

Proper citation: RRID:Addgene_169735 Copy   


  • RRID:Addgene_169731

http://www.addgene.org/169731

Species: Synthetic
Genetic Insert: tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6113; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556

Proper citation: RRID:Addgene_169731 Copy   


  • RRID:Addgene_169732

http://www.addgene.org/169732

Species: Synthetic
Genetic Insert: miR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6104; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556
Comments: Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid.

Proper citation: RRID:Addgene_169732 Copy   


  • RRID:Addgene_169738

http://www.addgene.org/169738

Species: Synthetic
Genetic Insert: miR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:13287; Vector Backbone:pCEP4; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556
Comments: Please note the OriP sequence contains a deletion that is also found in Addgene plasmid (pCEP4-CXCR4) which was used as the backbone.

Proper citation: RRID:Addgene_169738 Copy   


  • RRID:Addgene_169920

http://www.addgene.org/169920

Species: Synthetic
Genetic Insert: SpCas9-N57
Vector Backbone Description: Backbone Marker:Addgene # 52962; Vector Backbone:pCAG-spCas9; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32986839

Proper citation: RRID:Addgene_169920 Copy   


http://www.addgene.org/169912

Species: Synthetic
Genetic Insert: dCjCas9
Vector Backbone Description: Backbone Marker:Addgene #89752; Vector Backbone:pRGEN-CMV-CjCas9; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33751124

Proper citation: RRID:Addgene_169912 Copy   


  • RRID:Addgene_169873

http://www.addgene.org/169873

Species: Synthetic
Genetic Insert: sgRNA towards glpR in Pseudomonas putida
Vector Backbone Description: Vector Backbone:pBBR1k-GFP; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34175462

Proper citation: RRID:Addgene_169873 Copy   


http://www.addgene.org/169892

Species: Synthetic
Genetic Insert: sgRNA targeting ACO1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: CCACTACCCCAACCTGGCGG

Proper citation: RRID:Addgene_169892 Copy   


http://www.addgene.org/169894

Species: Synthetic
Genetic Insert: sgRNA targeting IREB2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: AATGCACCAAATCCTGGAGG

Proper citation: RRID:Addgene_169894 Copy   


  • RRID:Addgene_169792

    This resource has 1+ mentions.

http://www.addgene.org/169792

Species: Synthetic
Genetic Insert: OxLight1
Vector Backbone Description: Backbone Marker:Viral Vector Facility - University of Zurich; Backbone Size:4438; Vector Backbone:pAAV.hSynapsin1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35145320

Proper citation: RRID:Addgene_169792 Copy   


http://www.addgene.org/169745

Species: Synthetic
Genetic Insert: eGFP
Vector Backbone Description: Backbone Size:8535; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556

Proper citation: RRID:Addgene_169745 Copy   


http://www.addgene.org/169747

Species: Synthetic
Genetic Insert: tetR-P2A-eGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6113; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556
Comments: Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid.

Proper citation: RRID:Addgene_169747 Copy   


  • RRID:Addgene_170112

http://www.addgene.org/170112

Species: Synthetic
Genetic Insert: RRRAA
Vector Backbone Description: Vector Backbone:pHG165c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34369028

Proper citation: RRID:Addgene_170112 Copy   


  • RRID:Addgene_170107

http://www.addgene.org/170107

Species: Synthetic
Genetic Insert: UUUUA
Vector Backbone Description: Vector Backbone:pHG165c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34369028

Proper citation: RRID:Addgene_170107 Copy   


  • RRID:Addgene_170108

http://www.addgene.org/170108

Species: Synthetic
Genetic Insert: MelR
Vector Backbone Description: Vector Backbone:pHG165c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34369028

Proper citation: RRID:Addgene_170108 Copy   


  • RRID:Addgene_170103

    This resource has 1+ mentions.

http://www.addgene.org/170103

Species: Synthetic
Genetic Insert: bpNLS-nSpCas9(H840A)-MMLVRT-bpNLS-6xHis
Vector Backbone Description: Backbone Size:5238; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33927418
Comments: This is a bacterial codon-optimized SpCas9 (H840A) sequence within pET-28b backbone (Addgene #73018) fused to bipartite NLS, a 33-amino acid linker and the engineered M-MLV RT from the parental pCMV-PE2 plasmid (Addgene #132775). To this construct, a short GS linker and a 6xHis-tag are added to C terminus.

Proper citation: RRID:Addgene_170103 Copy   


  • RRID:Addgene_170100

http://www.addgene.org/170100

Species: Synthetic
Genetic Insert: deGFP
Vector Backbone Description: Backbone Size:2400; Vector Backbone:pBEST; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34985758

Proper citation: RRID:Addgene_170100 Copy   


  • RRID:Addgene_170099

http://www.addgene.org/170099

Species: Synthetic
Genetic Insert: deGFP
Vector Backbone Description: Backbone Size:2400; Vector Backbone:pBEST; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34985758

Proper citation: RRID:Addgene_170099 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X