Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGL3Basic-Mdm3-T5 Resource Report Resource Website |
RRID:Addgene_32373 | Mdm2 promoter | Mus musculus | Ampicillin | PMID:15090541 | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:40 | 0 | ||
|
pGL3Basic-Mdm2-T4 Resource Report Resource Website |
RRID:Addgene_32370 | Mdm2 promoter | Mus musculus | Ampicillin | PMID:15090541 | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:40 | 0 | ||
|
PGL3Basic-Mdm2-T1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32365 | Mdm2 promoter | Mus musculus | Ampicillin | PMID:15090541 | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:45 | 1 | ||
|
pEGFP-N1-CaMKKbeta Resource Report Resource Website 1+ mentions |
RRID:Addgene_32453 | Calcium/Calmodulin dependent protein kinase kinase beta | Mus musculus | Kanamycin | PMID:21669867 | A W374C mutation is also present in the pEGFP-N1-CaMKKbeta constructs that were used in this publication. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:41 | 1 | |
|
pET28-mE1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_32534 | E1, ubiquitin-activating enzyme | Mus musculus | Kanamycin | PMID:22012022 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET-28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:47 | 21 | ||
|
CMV-FFluc-GPD1L-3'UTR Seed Mut Resource Report Resource Website |
RRID:Addgene_32490 | GPD1L 3'UTR | Mus musculus | Ampicillin | PMID:21555452 | Seed mutant sequence - GTCGACCTCAGTGAATGCGTGTC | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:46 | 0 | |
|
pcDNA-FLAG-GPD1L Resource Report Resource Website |
RRID:Addgene_32486 | GPD1L | Mus musculus | Ampicillin | PMID:21555452 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:41 | 0 | ||
|
pcDNA-FLAG-GPD1 Resource Report Resource Website |
RRID:Addgene_32487 | GPD1 | Mus musculus | Ampicillin | PMID:21555452 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:46 | 0 | ||
|
pOZ-Pax7-FH-C-puro Resource Report Resource Website |
RRID:Addgene_32518 | Pax7d | Mus musculus | Ampicillin | PMID:19458195 | Backbone Marker:Addgene plasmid #32516; Backbone Size:7900; Vector Backbone:pOZ-FH-C-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:42 | 0 | ||
|
pXcX-3.6TPH-GAL4p65 Resource Report Resource Website |
RRID:Addgene_32573 | Gal4p65 | Mus musculus | Ampicillin | PMID:19298646 | Vector Backbone:pXcX; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:42 | 0 | ||
|
pTYF-3.6TPH-GAL4p65 Resource Report Resource Website |
RRID:Addgene_32571 | Gal4p65 | Mus musculus | Ampicillin | PMID:19212426 | Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:47 | 0 | ||
|
pENTR-L1-CAMKII(1.3)-L4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32577 | CAMKIIalpha promoter 1.3kb version | Mus musculus | Kanamycin | PMID:21772812 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P1-P4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:42 | 1 | ||
|
pENTR-L1-CAMKII(0.4)-R5 Resource Report Resource Website |
RRID:Addgene_32578 | CAMKIIalpha promoter 0.4kb version | Mus musculus | Kanamycin | PMID:21772812 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P1-P5r; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:47 | 0 | ||
|
pENTR-L5-Kir2.1-mCherry-L2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32669 | Kir2.1-mCherry | Mus musculus | Kanamycin | PMID:21772812 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P5-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:43 | 4 | ||
|
pGEMTEZ-Kir2.1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32641 | Kir2.1 | Mus musculus | Ampicillin | PMID:15157418 | Addgene's sequencing results identified a single nucleotide insertion at bp#60/61 when compared to the author's sequence. The insert is upstream of the coding region and should not be a concern for the intended purpose of the plasmid. Silent mutations in Kir2.1 that do not affect the amino acid sequence were also found in Addgene's sequencing results. | Backbone Marker:Promega; Vector Backbone:pGEM-T Easy; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:48 | 3 | |
|
pTetO-Kir2.1-IRES-TLZ Resource Report Resource Website 1+ mentions |
RRID:Addgene_32642 | tetO-Kir2.1-IRES-TLZ | Mus musculus | Ampicillin | PMID:15157418 | Addgene's sequencing results identified a single nucleotide a single nucleotide deletion at bp#1135 when compared to the author's sequence. The insert is upstream of the coding region and should not be a concern for the intended purpose of the plasmid. Silent mutations in Kir2.1 that do not affect the amino acid sequence were also found in Addgene's sequencing results. | Backbone Marker:Stratagene; Vector Backbone:pBlueScript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:43 | 1 | |
|
EGFP-talin1 rod Resource Report Resource Website 1+ mentions |
RRID:Addgene_32855 | Talin 1 Rod aa 434-2541 | Mus musculus | Kanamycin | PMID:17114441 | Please note that both the full plasmid sequence from the depositing laboratory and Addgene's sequencing results indicate a K673N mutation/SNP when the sequences are compared to GenBank entry NP_035732.2. The depositing laboratory states that this difference is not a concern for the function of the plasmid. The most appropriate reference sequence for the Talin1 insert in the plasmid is GenBank accession number CAA39588.1. | Backbone Marker:BD Clontech; Backbone Size:4749; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:44 | 3 | |
|
pcDNA mouse NHERF-1 (1-355) Resource Report Resource Website 1+ mentions |
RRID:Addgene_32705 | solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 | Mus musculus | Ampicillin | PMID:11457730 | Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1/Hygro(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | none | 2026-08-15 01:13:43 | 1 | |
|
p3XFlag-CMV10-Flag-mMcl-1 KR Resource Report Resource Website 1+ mentions |
RRID:Addgene_32979 | Mcl-1 | Mus musculus | Ampicillin | PMID:20385764 | Backbone Marker:Sigma; Backbone Size:6307; Vector Backbone:p3XFlag-CMV10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | All lys changed to Arg | 2026-08-15 01:13:45 | 3 | |
|
pCGN-MEF2D Resource Report Resource Website 1+ mentions |
RRID:Addgene_32963 | MEF2D | Mus musculus | Ampicillin | Backbone Marker:M. Tanaka; Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | E287G | 2026-08-15 01:13:45 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
