Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Mdm2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15090541
Proper citation: RRID:Addgene_32373 Copy
Species: Mus musculus
Genetic Insert: Mdm2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15090541
Proper citation: RRID:Addgene_32370 Copy
Species: Mus musculus
Genetic Insert: Mdm2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15090541
Proper citation: RRID:Addgene_32365 Copy
Species: Mus musculus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21669867
Comments: A W374C mutation is also present in the pEGFP-N1-CaMKKbeta constructs that were used in this publication.
Proper citation: RRID:Addgene_32453 Copy
Species: Mus musculus
Genetic Insert: E1, ubiquitin-activating enzyme
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET-28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22012022
Proper citation: RRID:Addgene_32534 Copy
Species: Mus musculus
Genetic Insert: GPD1L 3'UTR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555452
Comments: Seed mutant sequence - GTCGACCTCAGTGAATGCGTGTC
Proper citation: RRID:Addgene_32490 Copy
Species: Mus musculus
Genetic Insert: GPD1L
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555452
Proper citation: RRID:Addgene_32486 Copy
Species: Mus musculus
Genetic Insert: GPD1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555452
Proper citation: RRID:Addgene_32487 Copy
Species: Mus musculus
Genetic Insert: Pax7d
Vector Backbone Description: Backbone Marker:Addgene plasmid #32516; Backbone Size:7900; Vector Backbone:pOZ-FH-C-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19458195
Proper citation: RRID:Addgene_32518 Copy
Species: Mus musculus
Genetic Insert: Gal4p65
Vector Backbone Description: Vector Backbone:pXcX; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19298646
Proper citation: RRID:Addgene_32573 Copy
Species: Mus musculus
Genetic Insert: Gal4p65
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19212426
Proper citation: RRID:Addgene_32571 Copy
Species: Mus musculus
Genetic Insert: CAMKIIalpha promoter 1.3kb version
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P1-P4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Proper citation: RRID:Addgene_32577 Copy
Species: Mus musculus
Genetic Insert: CAMKIIalpha promoter 0.4kb version
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P1-P5r; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Proper citation: RRID:Addgene_32578 Copy
Species: Mus musculus
Genetic Insert: Kir2.1-mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P5-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Proper citation: RRID:Addgene_32669 Copy
Species: Mus musculus
Genetic Insert: Kir2.1
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGEM-T Easy; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15157418
Comments: Addgene's sequencing results identified a single nucleotide insertion at bp#60/61 when compared to the author's sequence. The insert is upstream of the coding region and should not be a concern for the intended purpose of the plasmid. Silent mutations in Kir2.1 that do not affect the amino acid sequence were also found in Addgene's sequencing results.
Proper citation: RRID:Addgene_32641 Copy
Species: Mus musculus
Genetic Insert: tetO-Kir2.1-IRES-TLZ
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBlueScript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15157418
Comments: Addgene's sequencing results identified a single nucleotide a single nucleotide deletion at bp#1135 when compared to the author's sequence. The insert is upstream of the coding region and should not be a concern for the intended purpose of the plasmid. Silent mutations in Kir2.1 that do not affect the amino acid sequence were also found in Addgene's sequencing results.
Proper citation: RRID:Addgene_32642 Copy
Species: Mus musculus
Genetic Insert: Talin 1 Rod aa 434-2541
Vector Backbone Description: Backbone Marker:BD Clontech; Backbone Size:4749; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17114441
Comments: Please note that both the full plasmid sequence from the depositing laboratory and Addgene's sequencing results indicate a K673N mutation/SNP when the sequences are compared to GenBank entry NP_035732.2. The depositing laboratory states that this difference is not a concern for the function of the plasmid. The most appropriate reference sequence for the Talin1 insert in the plasmid is GenBank accession number CAA39588.1.
Proper citation: RRID:Addgene_32855 Copy
Species: Mus musculus
Genetic Insert: solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1/Hygro(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11457730
Proper citation: RRID:Addgene_32705 Copy
Species: Mus musculus
Genetic Insert: Mcl-1
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:6307; Vector Backbone:p3XFlag-CMV10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20385764
Proper citation: RRID:Addgene_32979 Copy
Species: Mus musculus
Genetic Insert: MEF2D
Vector Backbone Description: Backbone Marker:M. Tanaka; Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_32963 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
