Plasmids   Select Another Resource Report Type

http://www.addgene.org/63101

Species: Homo sapiens
Genetic Insert: hspb10
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20843828

Proper citation: RRID:Addgene_63101 Copy   

•   Source: Addgene

http://www.addgene.org/63102

Species: Homo sapiens
Genetic Insert: hspb1
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20843828

Proper citation: RRID:Addgene_63102 Copy   

•   Source: Addgene

http://www.addgene.org/63103

Species: Homo sapiens
Genetic Insert: hspb2
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20843828

Proper citation: RRID:Addgene_63103 Copy   

•   Source: Addgene

http://www.addgene.org/63215

Species: Synthetic
Genetic Insert: His-T7-eGFP
Vector Backbone Description: Backbone Marker:Jakob Reiser; Backbone Size:10680; Vector Backbone:pNL-eGFP/CEF; Vector Types:Mammalian Expression, Bacterial Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22639380
Comments: Lentiviral vector with high transduction efficiency. Expression from the CMV-EF1α hybrid (CEF) promoter is very stable in mammalian cells. The lentivirus contains an SV40 origin 5’ to the eGFP gene. This influences gene targeting rates and the preferred strand for gene targeting and recombineering in cells expressing the SV40 T-antigen.

Proper citation: RRID:Addgene_63215 Copy   

•   Source: Addgene

http://www.addgene.org/63213

Vector Backbone Description: Backbone Size:2900; Vector Backbone:pUC19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25756291

Proper citation: RRID:Addgene_63213 Copy   

•   Source: Addgene

http://www.addgene.org/55220

Vector Backbone Description: Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28668116
Comments: In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-C has a TEV cleavable His6-MBP N10 at the N-terminus. MBP can improve expression and solubility of the target protein. The 438-C vector use the LICv1 Forward and Reverse primers. LICv1Forward - 5'-TACTTCCAATCCAATGCA-3' LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_55220 Copy   

•   Source: Addgene

http://www.addgene.org/55195

Species: Homo sapiens
Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:Sally Temple; Backbone Size:8000; Vector Backbone:pFUGw (Addgene id: 25870); Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24837679
Comments: Please see http://www.rle.mit.edu/sbg/resources/ for more information.

Proper citation: RRID:Addgene_55195 Copy   

•   Source: Addgene

http://www.addgene.org/55236

Species: Rattus norvegicus
Genetic Insert: CathespinB
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:2445929
Comments: . Excitation = 383; Emission = 448

Proper citation: RRID:Addgene_55236 Copy   

•   Source: Addgene

http://www.addgene.org/55241

Species: Homo sapiens
Genetic Insert: Fibrillarin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 383; Emission = 448

Proper citation: RRID:Addgene_55241 Copy   

•   Source: Addgene

http://www.addgene.org/55249

Species: Other
Genetic Insert: SV40 T-Antigen Nuclear Localization Signal (NLS)
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2-NLS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Nucleus = NLS. Excitation = 383; Emission = 448

Proper citation: RRID:Addgene_55249 Copy   

•   Source: Addgene

http://www.addgene.org/55246

Species: Rattus norvegicus
Genetic Insert: LAMP1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 383; Emission = 448

Proper citation: RRID:Addgene_55246 Copy   

•   Source: Addgene

http://www.addgene.org/55164

Species: Mus musculus
Genetic Insert: Wiskott-Aldrich Syndrome-like
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 587; Emission = 610

Proper citation: RRID:Addgene_55164 Copy   

•   Source: Addgene

http://www.addgene.org/55169

Vector Backbone Description: Backbone Marker:Hartl et al 2001; Vector Backbone:pAX01; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24295448
Comments: This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli. For sequencing of inserts, use the following primers: fwd: GGCAACCGAGCGTTCTG rev: CTGACAGCGTTTCGATCC

Proper citation: RRID:Addgene_55169 Copy   

•   Source: Addgene

http://www.addgene.org/55168

Vector Backbone Description: Backbone Marker:Guerout-Fleury, et al. 1996; Vector Backbone:pDG1662; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24295448
Comments: This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli. For sequencing of inserts, use the following primers: fwd: AAAGGTCATTGTTGACGCGG rev: GAGCGTAGCGAAAAATCC

Proper citation: RRID:Addgene_55168 Copy   

•   Source: Addgene

http://www.addgene.org/55166

Species: Homo sapiens
Genetic Insert: Zyxin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Excitation = 587; Emission = 610 May contain S11P, G42R and E62D mutations in human zyxin compared to reference sequence (NM_003461). These mutations should not affect function.

Proper citation: RRID:Addgene_55166 Copy   

•   Source: Addgene

http://www.addgene.org/55209

Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2CT-10 has a TEV-cleavable N-terminal His10-MBP fusion tag followed by Asn10. MBP can improve the expression and solubility of your target protein. The N10 linker may help you to avoid steric clashes between your protein and the MBP tag. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'-TACTTCCAATCCAATGCA-3' Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

Proper citation: RRID:Addgene_55209 Copy   

•   Source: Addgene

http://www.addgene.org/55207

Species: Renilla reniformis
Genetic Insert: Renilla luciferase
Vector Backbone Description: Backbone Marker:pGreen II; Backbone Size:2500; Vector Backbone:pGreen II; Vector Types:Luciferase, Plant transient expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24510721

Proper citation: RRID:Addgene_55207 Copy   

•   Source: Addgene

http://www.addgene.org/55294

Species: Homo sapiens
Genetic Insert: ER
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22174863
Comments: . Excitation = 399; Emission = 456

Proper citation: RRID:Addgene_55294 Copy   

•   Source: Addgene

http://www.addgene.org/55344

Species: Homo sapiens
Genetic Insert: H2B
Vector Backbone Description: Backbone Size:4750; Vector Backbone:ECFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Histone 2 B fusion. Excitation = 433; Emission = 475

Proper citation: RRID:Addgene_55344 Copy   

•   Source: Addgene

http://www.addgene.org/55368

Species: Homo sapiens
Genetic Insert: Fibrillarin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCerulean; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 433; Emission = 475

Proper citation: RRID:Addgene_55368 Copy   

•   Source: Addgene