Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Micromonospora rosaria RT-Cas1-Cas2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET30b+; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30283135
Comments: Please see the annotated GenBank file and the additional image file for the location of specific features in the sequence of this plasmid.
Proper citation: RRID:Addgene_116969 Copy
Species: Synthetic
Genetic Insert: Fusicatenibacter saccharivorans RT-Cas1-Cas2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET30b+; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30283135
Comments: Please see the annotated GenBank file and the additional image file for the location of specific features in the sequence of this plasmid.
Proper citation: RRID:Addgene_116963 Copy
Species: Synthetic
Genetic Insert: Fusicatenibacter saccharivorans RT-Cas1-Cas2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET30b+; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30283135
Comments: Please see the annotated GenBank file and the additional image file for the location of specific features in the sequence of this plasmid.
Proper citation: RRID:Addgene_116964 Copy
Species: Synthetic
Genetic Insert: Fusicatenibacter saccharivorans RT-Cas1-Cas2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET30b+; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30283135
Comments: Please see the annotated GenBank file and the additional image file for the location of specific features in the sequence of this plasmid.
Proper citation: RRID:Addgene_116965 Copy
Species: Synthetic
Genetic Insert: gDmap1 v4
Vector Backbone Description: Backbone Size:8629; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene: 67974); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30932271
Proper citation: RRID:Addgene_117143 Copy
Species: Synthetic
Genetic Insert: gDmap1 v5
Vector Backbone Description: Backbone Size:8629; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene: 67974); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30932271
Proper citation: RRID:Addgene_117144 Copy
Species: Synthetic
Genetic Insert: BSD2A
Vector Backbone Description: Backbone Size:9123; Vector Backbone:pKLV2-U6(BsmBI)-EF1a-BFP-Nkx2-5; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_117136 Copy
Species: Synthetic
Genetic Insert: gCD44 v2
Vector Backbone Description: Backbone Size:14044; Vector Backbone:pKLV2-U6(BsmBI)-EF1a-BFP-Puro-Cas9(FZ); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_117134 Copy
Species: Synthetic
Genetic Insert: gRNA miR-124-1-3'
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:9157; Vector Backbone:PX459; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30292704
Comments: Cas9 with NLS included
Proper citation: RRID:Addgene_117324 Copy
Species: Synthetic
Genetic Insert: miR-124 sponge
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:7334; Vector Backbone:pmiRGLO; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30292704
Proper citation: RRID:Addgene_117327 Copy
Species: Synthetic
Genetic Insert: SauCas9 sgRNA targeting TLR 2.0
Vector Backbone Description: Backbone Marker:Addgene#50920; Vector Backbone:pLKO.1-puro-U6; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36070530
Comments: Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function.
Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_117409 Copy
Species: Synthetic
Genetic Insert: SpyCas9 sgRNA targeting TLR 2.0
Vector Backbone Description: Backbone Marker:Addgene#50920; Vector Backbone:pLKO.1-puro-U6; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36070530
Comments: Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function.
Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_117406 Copy
Species: Synthetic
Genetic Insert: mPlum
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117396 Copy
Species: Synthetic
Genetic Insert: dTomato
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117395 Copy
Species: Synthetic
Genetic Insert: mPlum
Vector Backbone Description: Vector Backbone:pGEN-mcs (ori15A); Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117388 Copy
Species: Synthetic
Genetic Insert: GCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
Vector Backbone Description: Backbone Size:5352; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30626963
Proper citation: RRID:Addgene_117384 Copy
Species: Synthetic
Genetic Insert: mPlum
Vector Backbone Description: Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117392 Copy
Species: Synthetic
Genetic Insert: dTomato
Vector Backbone Description: Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117391 Copy
Species: Synthetic
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117394 Copy
Species: Synthetic
Genetic Insert: AsCas12a gRNA targeting TLR 2.0
Vector Backbone Description: Backbone Marker:Addgene#50920; Vector Backbone:pLKO.1-puro-U6; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36070530
Comments: Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function.
Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_117411 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
