Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Thermomicrobium roseum
Genetic Insert: β-glucosidase
Vector Backbone Description: Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29516725
Proper citation: RRID:Addgene_101910 Copy
Species: Thermobaculum terrenum
Genetic Insert: β-glucosidase
Vector Backbone Description: Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29516725
Proper citation: RRID:Addgene_101911 Copy
Species: Homo sapiens
Genetic Insert: PTEN induced putative kinase 1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20126261
Proper citation: RRID:Addgene_101874 Copy
Vector Backbone Description: Backbone Marker:Bassik lab (Addgene Plasmid #89359); Vector Backbone:pMCB320; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28474669
Proper citation: RRID:Addgene_101928 Copy
Species: Homo sapiens
Genetic Insert: SOX10 promoter targeting gRNA
Vector Backbone Description: Backbone Size:12806; Vector Backbone:WPLX destination vector; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29203910
Proper citation: RRID:Addgene_101923 Copy
Species: Homo sapiens
Genetic Insert: USP15_SART3
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SART3|USP15:YTC044-A09:C237276. SGC or PDG link: http://www.thesgc.org/structures/5JJW/
Proper citation: RRID:Addgene_101880 Copy
Species: Homo sapiens
Genetic Insert: SETDB1
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SETDB1:APC043-C07:C27642.
SGC or PDG links:
5KCH http://www.thesgc.org/structures/5KCH/
6AU2 http://www.thesgc.org/structures/6AU2/
6AU3 http://www.thesgc.org/structures/6AU3/
6BPI http://www.thesgc.org/structures/6BPI/
5KCO http://www.thesgc.org/structures/5KCO/
5KE2 http://www.thesgc.org/structures/5KE2/
5KE3 http://www.thesgc.org/structures/5KE3/
5KH6 http://www.thesgc.org/structures/5KH6/
Proper citation: RRID:Addgene_101881 Copy
Species: Homo sapiens
Genetic Insert: SETD8
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SETD8:PBC001-G01:C233009. SGC or PDG link:
http://www.thesgc.org/structures/5T5G/
http://www.thesgc.org/structures/5TH7/
Proper citation: RRID:Addgene_101886 Copy
Species: Leishmania donovani
Genetic Insert: PP-BRD3
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: LdBPK_091320.1:MAC055-F01:C235018. SGC or PDG link: http://www.thesgc.org/structures/5TCK/
Proper citation: RRID:Addgene_101887 Copy
Species: Leishmania donovani
Genetic Insert: PP-BRD3
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: LdBPK_091320.1:MAC055-C02:C235023.
SGC or PDG links:
http://www.thesgc.org/structures/5TCM/
http://www.thesgc.org/structures/6BYA/
Proper citation: RRID:Addgene_101888 Copy
Species: Homo sapiens
Genetic Insert: dCas9-TET1CD
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:10591; Vector Backbone:pINDUCER21 (ORF-EG); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29203910
Proper citation: RRID:Addgene_101921 Copy
Species: Homo sapiens
Genetic Insert: PREB
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 62304); Vector Backbone:pFBOH-MHL; Vector Types:Baculovirus expression; Bacterial Resistance:Ampicillin
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: PREB:YTC012-F10:C229890. SGC or PDG link: http://www.thesgc.org/structures/5TF2/
Proper citation: RRID:Addgene_101889 Copy
Species: Trypanosoma brucei
Genetic Insert: PP-BRD19
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: Tb427.10.8150:MAC054-H04:C234720. SGC or PDG link: http://www.thesgc.org/structures/5KO4/
Proper citation: RRID:Addgene_101882 Copy
Species: Homo sapiens
Genetic Insert: CBX3
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: CBX3:JMC081-D10:C229154. SGC or PDG link: http://www.thesgc.org/structures/5T1I/
Proper citation: RRID:Addgene_101885 Copy
Species: Homo sapiens
Genetic Insert: Rab interacting lysosomal protein
Vector Backbone Description: Backbone Size:4858; Vector Backbone:pTre2-Bla; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27791088
Proper citation: RRID:Addgene_102425 Copy
Genetic Insert: tetracyclin-transactivator (rtTA)
Vector Backbone Description: Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28504700
Comments: IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers:
Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC
Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG
Proper citation: RRID:Addgene_102423 Copy
Species: Homo sapiens
Genetic Insert: sgHAL
Vector Backbone Description: Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995852
Proper citation: RRID:Addgene_102315 Copy
Species: Homo sapiens
Genetic Insert: DNMT3A1
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28923089
Proper citation: RRID:Addgene_102278 Copy
Species: Synthetic
Genetic Insert: PA-mCherry
Vector Backbone Description: Backbone Marker:SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.; Backbone Size:7500; Vector Backbone:pSin4-EF2-IRES-Pur; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30983487
Comments: There is a "NheI" restriction site which we artificially added between PAmCherry and SNCA-NE to facilitate cloning. i.e. 5'---PAmCherry-NheI-SNCA-NE----3'
This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/)
Proper citation: RRID:Addgene_102364 Copy
Species: Synthetic
Genetic Insert: PA-mCherry
Vector Backbone Description: Backbone Marker:SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.; Backbone Size:7500; Vector Backbone:pSin4-EF2-IRES-Pur; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30983487
Comments: "KFERQ" is the consensus peptide sequence found in various native proteins for mediating degradation via Chaperone-Mediated Autophagy (CMA)
There is a "NheI" restriction site which we artificially added between PAmCherry and KFERQ-NE to facilitate cloning. i.e. 5'---PAmCherry-NheI-KFERQ-NE----3'
This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/)
Proper citation: RRID:Addgene_102365 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
