Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: halotag::HDEL (includes STOP codon, PATC introns)
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:3519; Vector Backbone:Zero blunt TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31848219
Proper citation: RRID:Addgene_139044 Copy
Species: Caenorhabditis elegans
Genetic Insert: halotag (no STOP codon, PATC introns)
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:3519; Vector Backbone:Zero blunt TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31848219
Proper citation: RRID:Addgene_139030 Copy
Species: Caenorhabditis elegans
Genetic Insert: gfp (no STOP codon, PATC introns)
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:3519; Vector Backbone:Zero blunt TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31848219
Proper citation: RRID:Addgene_139031 Copy
Species: Caenorhabditis elegans
Genetic Insert: halotag (no STOP codon, PATC introns)
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:3519; Vector Backbone:Zero blunt TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31848219
Proper citation: RRID:Addgene_139045 Copy
Species: Caenorhabditis elegans
Genetic Insert: epdz (includes STOP codon)
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:3519; Vector Backbone:Zero blunt TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31848219
Proper citation: RRID:Addgene_139049 Copy
Species: Caenorhabditis elegans
Genetic Insert: mScarlet (no STOP codon)
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:3519; Vector Backbone:Zero blunt TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31848219
Proper citation: RRID:Addgene_139047 Copy
Species: Caenorhabditis elegans
Genetic Insert: tbb-2 3'UTR
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:3519; Vector Backbone:Zero blunt TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31848219
Proper citation: RRID:Addgene_139052 Copy
Species: Caenorhabditis elegans
Genetic Insert: pie-1 3'UTR
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:3519; Vector Backbone:Zero blunt TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31848219
Proper citation: RRID:Addgene_139051 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pacr-2
Vector Backbone Description: Backbone Marker:Invitrogen Gateway; Backbone Size:4500; Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20027209
Proper citation: RRID:Addgene_135092 Copy
Species: Caenorhabditis elegans
Genetic Insert: sgRNA for cxTi10082 (actgttggatgcctgtgtag)
Vector Backbone Description: Backbone Marker:Goldstein Lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31378567
Proper citation: RRID:Addgene_135094 Copy
Species: Caenorhabditis elegans
Genetic Insert: mNG-GLO^SEC^3xFlag + ccdB
Vector Backbone Description: Backbone Size:3881; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_137017 Copy
Species: Caenorhabditis elegans
Genetic Insert: mKate2-GLO^SEC^3xFlag + ccdB
Vector Backbone Description: Backbone Size:3881; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_137019 Copy
Species: Caenorhabditis elegans
Genetic Insert: mTurq2-GLO^SEC^2xHA + ccdB
Vector Backbone Description: Backbone Size:3881; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_137020 Copy
Species: Caenorhabditis elegans
Genetic Insert: C. elegans GLO-optimized mKate2
Vector Backbone Description: Backbone Size:2540; Vector Backbone:pDONR221; Vector Types:Worm Expression, CRISPR, SapTrap donor for cloning repair templates for C. elegans; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_137022 Copy
Species: Caenorhabditis elegans
Genetic Insert: C. elegans GLO-optimized mNeonGreen
Vector Backbone Description: Backbone Size:2540; Vector Backbone:pDONR221; Vector Types:Worm Expression, CRISPR, SapTrap donor for cloning repair templates for C. elegans; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_137024 Copy
Species: Caenorhabditis elegans
Genetic Insert: C. elegans GLO-optimized mScarlet
Vector Backbone Description: Backbone Size:2540; Vector Backbone:pDONR221; Vector Types:Worm Expression, CRISPR, SapTrap donor for cloning repair templates for C. elegans; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_137025 Copy
Species: Caenorhabditis elegans
Genetic Insert: Ska1 MTBD-His
Vector Backbone Description: Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29153323
Proper citation: RRID:Addgene_134141 Copy
Species: Caenorhabditis elegans
Genetic Insert: KNL1 FL with YA mutant
Vector Backbone Description: Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25411336
Proper citation: RRID:Addgene_134201 Copy
Species: Caenorhabditis elegans
Genetic Insert: KNL1 aa 69-235
Vector Backbone Description: Vector Backbone:pRSETa; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25411336
Proper citation: RRID:Addgene_134182 Copy
Species: Caenorhabditis elegans
Genetic Insert: KNL1 aa 69 - 479
Vector Backbone Description: Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25411336
Proper citation: RRID:Addgene_134187 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
