Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: rab25a
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_80544 Copy
Species: Danio rerio
Genetic Insert: rab24
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_80543 Copy
Species: Danio rerio
Genetic Insert: rab23
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_80542 Copy
Species: Danio rerio
Genetic Insert: rab39bb
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_80560 Copy
Species: Danio rerio
Genetic Insert: rab43
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_80565 Copy
Species: Danio rerio
Genetic Insert: rab40c
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_80562 Copy
Species: Danio rerio
Genetic Insert: rab41
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_80561 Copy
Species: Danio rerio
Genetic Insert: mitfa
Vector Backbone Description: Vector Backbone:pCS2-MT; Vector Types:Mammalian Expression, zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10433906
Comments: Also called pCS2-MT3A.1
Proper citation: RRID:Addgene_81231 Copy
Species: Danio rerio
Genetic Insert: arr3a
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:3973; Vector Backbone:pcRII-TOPO; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21299656
Proper citation: RRID:Addgene_78167 Copy
Species: Danio rerio
Genetic Insert: -3mnx1
Vector Backbone Description: Backbone Marker:Chien Lab; Backbone Size:4143; Vector Backbone:pTol2pA2; Vector Types:Zebrafish motor neuron expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27631880
Comments: Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
Proper citation: RRID:Addgene_78250 Copy
Species: Danio rerio
Genetic Insert: GESTALT lineage tracing target V6
Vector Backbone Description: Backbone Size:12262; Vector Backbone:Tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27229144
Comments: GESTALT V6 barcode for integration into zebrafish using the Tol2 system
Proper citation: RRID:Addgene_78628 Copy
Species: Danio rerio
Genetic Insert: acta2 promoter
Vector Backbone Description: Backbone Marker:Koichi Kawakami/ Chi-Bin Chien; Backbone Size:2417; Vector Backbone:pDestTol pA2; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24594685
Proper citation: RRID:Addgene_78685 Copy
Species: Danio rerio
Genetic Insert: smtn-b
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17474123
Proper citation: RRID:Addgene_78710 Copy
Species: Danio rerio
Genetic Insert: nm-mhc-b
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17474123
Comments: Primers used to amplify cDNA:
CCTGAGCCGAGAGGTCAA and CACGGAGAGCTGCAGGAG
Proper citation: RRID:Addgene_78709 Copy
Species: Danio rerio
Genetic Insert: cpi-17
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17474123
Comments: Primers used to amplify cDNA:
ATGGCTGAGGAGACACATAC and CTCCTCTGGCATGTCCTCA
Proper citation: RRID:Addgene_78708 Copy
Species: Danio rerio
Genetic Insert: 2A-mRFP; HE1A: BFP
Vector Backbone Description: Backbone Marker:Karl J. Clark; Backbone Size:2730; Vector Backbone:pK; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35713402
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.06.18.448732v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_180007 Copy
Species: Danio rerio
Genetic Insert: 2A-mRFP; HE1A: BFP
Vector Backbone Description: Backbone Marker:Karl J. Clark; Backbone Size:2730; Vector Backbone:pK; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35713402
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.06.18.448732v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_180008 Copy
Species: Danio rerio
Genetic Insert: 2A-mRFP; HE1A: BFP
Vector Backbone Description: Backbone Marker:Karl J. Clark; Backbone Size:2730; Vector Backbone:pK; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35713402
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.06.18.448732v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_180009 Copy
Species: Danio rerio
Genetic Insert: 2A-KalTA4; HE1A: BFP
Vector Backbone Description: Backbone Marker:Karl J. Clark; Backbone Size:2730; Vector Backbone:pK; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35713402
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.06.18.448732v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_180010 Copy
Species: Danio rerio
Genetic Insert: 2A-KalTA4; HE1A: BFP
Vector Backbone Description: Backbone Marker:Karl J. Clark; Backbone Size:2730; Vector Backbone:pK; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35713402
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.06.18.448732v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_180011 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
