Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: TCR beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1419956
Comments: Insert is a 14.5 kb fragment containing the TCR beta-chain coding and promoter regions but lacking the 3' TCR beta-chain enhancer.
Proper citation: RRID:Addgene_69569 Copy
Species: Mus musculus
Genetic Insert: Runx1 +23 intronic enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pENTR attL4-R1; Vector Types:5' Gateway Entry Vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25594182
Comments: All PCR was performed using the High Fidelity Advantage 2 PCR Kit (Clontech). The Runx1 +23 enhancer (1) was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (XhoI and BamHI sites added) 5’-GGCTCGAGGGATCCGGGGTGGGAGGTGTAAGTTC-3’ and Reverse (BglII and NotI sites added) 5’- GGGCGGCCGCAGATCTCAGGTGTCAGCAACCCATC -3’. The PCR fragment was gel purified, XhoI/BglII digested, ligated into XhoI/BamHI digested Tol2kit (2) #228 p5E-MCS vector and sequence verified. The mouse beta-globin minimal promoter was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (SpeI site added) 5’-GGACTAGTCCAATCTGCTCAGAGAGGACA-3’ and Reverse (SacII site added) 5’-GGCCGCGGGATGTCTGTTTCTGAGGTTGC-3’. The beta-globin minimal promoter and Runx1+23 5’ entry vector were SpeI/SacII digested and ligated together. Multisite Gateway reactions were performed according to the Invitrogen protocol.
1. Nottingham, W. T., Jarratt, A., Burgess, M., Speck, C. L., Cheng, J.-F., Prabhakar, S., et al. (2007). Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer. Blood, 110(13), 4188–4197. http://doi.org/10.1182/blood-2007-07-100883
2. Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E., Campbell, D. S., et al. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Developmental Dynamics : an Official Publication of the American Association of Anatomists, 236(11), 3088–3099. http://doi.org/10.1002/dvdy.21343
Proper citation: RRID:Addgene_69602 Copy
Species: Mus musculus
Genetic Insert: NBL10
Vector Backbone Description: Backbone Marker:Karl Deisseroth; Backbone Size:5600; Vector Backbone:pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24855954
Comments: See also Nectow et al., Nature Protocols (2015).
Proper citation: RRID:Addgene_69971 Copy
Species: Mus musculus
Genetic Insert: Dnd1
Vector Backbone Description: Backbone Marker:Addgene #10878; Backbone Size:7032; Vector Backbone:pLKO.1-TRC cloning vector; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28297718
Comments: TRC Clone ID TRCN0000217421
Proper citation: RRID:Addgene_70058 Copy
Species: Mus musculus
Genetic Insert: eIF4A1
Vector Backbone Description: Backbone Size:6500; Vector Backbone:MSCV IRES GFP (MIG); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25079319
Proper citation: RRID:Addgene_70043 Copy
Species: Mus musculus
Genetic Insert: Dnd1
Vector Backbone Description: Backbone Size:11522; Vector Backbone:CS-TRE-mOKS-PRE-Ubc-rTTA-I2G; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28297718
Comments: Silent mutations are introduced to escape from RNAi using pLKO.1-shDnd1-No. 1,6, and 8 deposited in Addgene (plasmids #70058, 70067, and 70069).
Proper citation: RRID:Addgene_70076 Copy
Species: Mus musculus
Genetic Insert: Dnd1
Vector Backbone Description: Backbone Marker:Addgene #10878; Backbone Size:7032; Vector Backbone:pLKO.1-TRC cloning vector; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28297718
Comments: TRC Clone ID TRCN0000247050
Proper citation: RRID:Addgene_70068 Copy
Species: Mus musculus
Genetic Insert: Dnd1
Vector Backbone Description: Backbone Marker:Addgene #10878; Backbone Size:7032; Vector Backbone:pLKO.1-TRC cloning vector; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28297718
Comments: TRC Clone ID TRCN0000247051
Proper citation: RRID:Addgene_70067 Copy
Species: Mus musculus
Genetic Insert: Eomes
Vector Backbone Description: Backbone Marker:Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.); Backbone Size:8370; Vector Backbone:pLV-tetO; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26412560
Comments:
The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).
Proper citation: RRID:Addgene_70271 Copy
Species: Mus musculus
Genetic Insert: GATA binding protein 3
Vector Backbone Description: Backbone Marker:Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.) ; Backbone Size:8370; Vector Backbone:pLV-tetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26412560
Comments: The coding sequence for murine Gata3 (together with parts of the 5' and 3' UTR) was inserted into the EcoRI site of the pLV-tetO vector (pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, Addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University)
Proper citation: RRID:Addgene_70270 Copy
Species: Mus musculus
Genetic Insert: Ets2
Vector Backbone Description: Backbone Marker:Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.) ; Backbone Size:8370; Vector Backbone:pLV-tetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26412560
Comments: The cDNA sequence of murine Ets2 was amplified from undifferentiated trophoblast stem cells and inserted into the pCR2.1 vector. From there it was excised by EcoRI digest and ligated into the pLV-tetO vector via the EcoRI site. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).
Proper citation: RRID:Addgene_70272 Copy
Species: Mus musculus
Genetic Insert: Tfap2a
Vector Backbone Description: Backbone Marker:Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.) ; Backbone Size:8370; Vector Backbone:pLV-tetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26412560
Comments: The cDNA sequence of murine Tfap2a (coding region and partially 5' and 3' UTR) was inserted into the pLV-tetO vector via the EcoRI site. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).
Proper citation: RRID:Addgene_70274 Copy
Species: Mus musculus
Genetic Insert: Trophoblast specific protein alpha
Vector Backbone Description: Backbone Marker:Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.); Vector Backbone:pLV-tetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26412560
Comments: The coding sequence for murine Tpbpa (together with parts of the 5' and 3' UTR) was inserted into the EcoRI site of the pLV-tetO vector (pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, Addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University)
Proper citation: RRID:Addgene_70698 Copy
Species: Mus musculus
Genetic Insert: 5´-GGCTCATGATGGCCAACCACCAAGCTTGGTGGTTGGCCATCATGAGCCCTTTTTC-3´ 5´-CCGAGTACTACCGGTTGGTGGTTCGAACCACCAACCGGTAGTACTCGGGAAAAAGTTAA-3´
Vector Backbone Description: Vector Backbone:pBluescript/U6; Vector Types:Mammalian Expression, U6 promoter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21788450
Comments: Please note there is a single nucleotide mismatch between the depositor's sequence and Addgene's quality control sequence. This mismatch does not affect plasmid function.
Proper citation: RRID:Addgene_70666 Copy
Species: Mus musculus
Genetic Insert: Tropomodulin3 1-163 AA fragment
Vector Backbone Description: Backbone Size:5006; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25575350
Proper citation: RRID:Addgene_70754 Copy
Species: Mus musculus
Genetic Insert: Elf5
Vector Backbone Description: Backbone Marker:Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.); Backbone Size:8370; Vector Backbone:pLV-tetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26412560
Comments: The cDNA sequence of murine Elf5 was amplified from trophoblast stem cell cDNA and subcloned into the pCR2.1 vector. From there it was excised via BamHI and EcoRV and inserted into the pLV-tetO vector via the EcoRI site after Klenow treatment of both vector backbone and insert. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).
Proper citation: RRID:Addgene_70772 Copy
Species: Mus musculus
Genetic Insert: ATP Citrate Lyase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5800; Vector Backbone:pEF6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24998913
Proper citation: RRID:Addgene_70765 Copy
Species: Mus musculus
Genetic Insert: inhibitor of DNA binding 2
Vector Backbone Description: Backbone Marker:Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.); Backbone Size:8370; Vector Backbone:pLV-tetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26412560
Comments: The cDNA sequence of murine Id2 was amplified and subcloned into the pCR2.1 vector. From there it was excised via HindIII and EcoRV and inserted into the pLV-tetO vector via the EcoRI site after Klenow treatment of both vector backbone and insert. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).
Proper citation: RRID:Addgene_70764 Copy
Species: Mus musculus
Genetic Insert: B108-Otx2 (isoform b)-IRES-Cre
Vector Backbone Description: Backbone Marker:Addgene, Plasmid #28177; Backbone Size:3298; Vector Backbone:stagia3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25155555
Proper citation: RRID:Addgene_73993 Copy
Species: Mus musculus
Genetic Insert: Chx10BP-loxP-mCherry-loxP-EGFP
Vector Backbone Description: Backbone Marker:Mark Emerson and Connie Cepko; Backbone Size:3221; Vector Backbone:Stagia3 (Addgene Plasmid #28177); Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25155555
Proper citation: RRID:Addgene_73992 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
