Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pCMV5-ActRIIA Resource Report Resource Website 1+ mentions |
RRID:Addgene_11754 | Activin receptor IIA | Mus musculus | Ampicillin | PMID:9748228 | Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-24 02:03:54 | 1 | ||
|
pCMV5-Flag-RhoA K6,7R Resource Report Resource Website |
RRID:Addgene_11751 | RhoA | Homo sapiens | Ampicillin | PMID:15761148 | Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K6,7R | Addgene | 2026-10-24 02:03:53 | 0 | |
|
pCMV5-Flag-RhoA wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_11750 | RhoA | Homo sapiens | Ampicillin | PMID:15761148 | Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-24 02:03:53 | 2 | ||
|
pEPOR0SP0019 Resource Report Resource Website |
RRID:Addgene_117529 | Sp-eCas9 1.1 (no stop codon) | Streptococcus pyogenes | Spectinomycin | PMID:30811422 | Compatible with MoClo, Loop Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint | Vector Backbone:pAGM1287; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin | K848A, K1003A, R1060A | Addgene | 2026-10-24 02:03:54 | 0 |
|
pEPOR0SP0018 Resource Report Resource Website |
RRID:Addgene_117528 | Sp-eCas9 1.1 (with stop codon) | Streptococcus pyogenes | Spectinomycin | PMID:30811422 | Compatible with MoClo, Loop Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint | Vector Backbone:pICH41308; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin | K848A, K1003A, R1060A | Addgene | 2026-10-24 02:03:54 | 0 |
|
pEPOR0SP0015 Resource Report Resource Website |
RRID:Addgene_117525 | SpCas9-KA (no stop codon) | Streptococcus pyogenes | Spectinomycin | PMID:30811422 | Compatible with MoClo, Loop Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint | Vector Backbone:pAGM1287; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin | K855A | Addgene | 2026-10-24 02:03:54 | 0 |
|
pEPOR0SP0017 Resource Report Resource Website |
RRID:Addgene_117527 | Sp-eCas9 1.0 (no stop codon) | Streptococcus pyogenes | Spectinomycin | PMID:30811422 | Compatible with MoClo, Loop Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint | Vector Backbone:pAGM1287; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin | K810A, K1003A, R1060A | Addgene | 2026-10-24 02:03:54 | 0 |
|
pCMV5B-ALK4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11756 | ALK4 | Homo sapiens | Ampicillin | PMID:9748228 | Backbone Size:4700; Vector Backbone:pCMV5B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-24 02:03:54 | 1 | ||
|
pHV739 Resource Report Resource Website |
RRID:Addgene_117477 | NMT2 | Homo sapiens | Kanamycin | PMID:11771383 | This plasmid also contains the gene that expresses E. coli methionine aminopeptidase under its own promoter | Vector Backbone:pMON; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-24 02:03:53 | 0 | |
|
pICSL12022 Resource Report Resource Website |
RRID:Addgene_117510 | BsaI:GGAG:pAG:AATG:BsaI | Arabidopsis thaliana | Spectinomycin | PMID:30625150 | pICSL12022 carries GGAG-TACT golden gate ends. It has to be cloned with a 5’UTR plasmid, TACT-AATG, when assembled with a CDS and terminator into Level 1. For instance pICH41402 (plasmid 50285 on Addgene) can be used. This assembly of promoter / 5’UTR / CDS / terminator can be done in a single reaction. Cloned by Laurence Tomlinson . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint. | Backbone Size:2247; Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | Addgene | 2026-10-24 02:03:53 | 0 | |
|
pHV738 Resource Report Resource Website |
RRID:Addgene_117476 | NMT1 | Homo sapiens | Kanamycin | PMID:11771383 | This plasmid also contains the gene that expresses E. coli methionine aminopeptidase under its own promoter | Vector Backbone:pMON; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-24 02:03:53 | 0 | |
|
BCJJ163 Resource Report Resource Website |
RRID:Addgene_117512 | BsaI:GGAG:pRPS5a:AATG:BsaI | Arabidopsis thaliana | Spectinomycin | PMID:30625150 | Cloned by Baptiste Castel . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint. | Backbone Size:2247; Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | Addgene | 2026-10-24 02:03:54 | 0 | |
|
pSC27 Resource Report Resource Website |
RRID:Addgene_117478 | Kanamycin | PMID:9514705 | Backbone Marker:Yanisch-Perron et al.; Backbone Size:2860; Vector Backbone:pTZ18U; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-24 02:03:53 | 0 | ||||
|
pICSL12021 Resource Report Resource Website |
RRID:Addgene_117511 | BsaI:GGAG:pICU2:AATG:BsaI | Arabidopsis thaliana | Spectinomycin | PMID:30625150 | Cloned by Laurence Tomlinson . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint. | Backbone Size:2247; Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | Addgene | 2026-10-24 02:03:54 | 0 | |
|
g16s pDONR Resource Report Resource Website |
RRID:Addgene_117473 | PSD4 | Homo sapiens | Kanamycin | Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Addgene | 2026-10-24 02:03:53 | 0 | |||
|
LBJJ382 Resource Report Resource Website |
RRID:Addgene_117518 | BpiI:ACTA:pU6-26:sgRNA-EF:t192bp:TTAC:BpiI | Synthetic | Ampicillin | PMID:30625150 | Cloned by Laurence Tomlinson. Primers to amplify a sgRNA: Fw: ga GGTCTCa ATTG [x] GTTTAAGAGCTATGCTGGAA, where [x] is the 20nt spacer/target sequence (NOT including the PAM). Rv: tgtggtctcaAGCGAAAAAAAGCACCGACTC (for polyT terminator) tgtggtctcaAGCGACCCCAGAAATTGAAC (for 67 bp U6-26 terminator, recommanded) tgtggtctcaAGCGTATTGGTTTATCTCATCG (for 192 bp U6-26 terminator). The PCR amplicon is ready to clone in a Golden Gate fashion with U6-26 promoter (pICSL90002) and any Golden Gate compatible acceptor vector Level 1, using BsaI. Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint. | Backbone Size:4352; Vector Backbone:pICH47751; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-24 02:03:54 | 0 | |
|
LBJJ383 Resource Report Resource Website |
RRID:Addgene_117517 | BpiI:ACTA:pU6-26:sgRNA:polyT:TTAC:BpiI | Synthetic | Ampicillin | PMID:30625150 | Cloned by Laurence Tomlinson. Primers to amplify a sgRNA: Fw: ga GGTCTCa ATTG [x] GTTTTAGAGCTAGAAATAGC, where [x] is the 20nt spacer/target sequence (NOT including the PAM). Rv: tgtggtctcaAGCGAAAAAAAGCACCGACTC. The PCR amplicon is ready to clone in a Golden Gate fashion with U6-26 promoter (pICSL90002) and any Golden Gate compatible acceptor vector Level 1, using BsaI. Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint. | Backbone Size:4352; Vector Backbone:pICH47751; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-24 02:03:54 | 0 | |
|
pICSL60004 Resource Report Resource Website 1+ mentions |
RRID:Addgene_117519 | BsaI:GCTT:E9t:CGCT:BsaI | Pisum sativum | Spectinomycin | PMID:30625150 | Cloned by Laurence Tomlinson . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint. | Backbone Size:2247; Vector Backbone:pICH41276; Vector Types:; Bacterial Resistance:Spectinomycin | Addgene | 2026-10-24 02:03:54 | 1 | |
|
pICSL90016 Resource Report Resource Website |
RRID:Addgene_117514 | BsaI:AATG:Cas9_2:GCTT:BsaI | Synthetic | Spectinomycin | PMID:30625150 | Cloned by Oleg Raitskin . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint. | Backbone Size:2247; Vector Backbone:pICH41308; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin | Addgene | 2026-10-24 02:03:54 | 0 | |
|
pMO746 Resource Report Resource Website |
RRID:Addgene_117480 | uracil phosphoribosyltransferase | Desulfovibrio vulgaris | Ampicillin and Kanamycin | PMID:23393089 | Selection for kanamycin resistance after introduction of pMO746 identifies those cells in which integration into the chromosome of part or all of the plasmid has occurred. Kanamycin resistance is a strong selection in the sulfate-reducing bacteria (SRB). Ampicillin is not universally effective in the SRB but is often used for selection in Escherichia coli. Thus this plasmid can be readily grown in E. coli but is actually unstable in the SRB. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCR4/TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | Addgene | 2026-10-24 02:03:53 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
