Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
CMV-R-GECO1.2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_45494 | R-GECO1.2 | Synthetic | Ampicillin | PMID:23452507 | Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R-GECO1 M164R/I166V/V174L/F222L/N267S/S270T/I330M/L419I | 2026-08-15 01:15:24 | 25 | |
|
pcDNA3 HA eIF4GI (1-1599) Resource Report Resource Website 1+ mentions |
RRID:Addgene_45640 | eIF4GI transcript variant 2 | Homo sapiens | Ampicillin | PMID:19114555 | For diagnostic digest, an additional PvuI digestion is necessary to distinguish the insert from the vector because of their similar sizes. The EIF4G1 translation contains M432V compared to NP_937884 (NM_198241.2); however the nucleotide change resulting in the amino acid change is more conserved between species, and it is located between functional domains of eIF4G1 (PABP-binding site and eIF4E-binding site), and does not affect its function as a translational factor | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 5 | |
|
pEGFP-HDAC4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45636 | HDAC4 | Homo sapiens | Kanamycin | PMID:17873280 | Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:25 | 4 | ||
|
pMKBAD28 Resource Report Resource Website |
RRID:Addgene_45595 | NpuDnaEC14 | Nostoc punctiforme | Ampicillin | PMID:23974115 | There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function. | Backbone Marker:Invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 0 | |
|
pD40-His/V5-c-Myc Resource Report Resource Website 1+ mentions |
RRID:Addgene_45597 | c-Myc | Mus musculus | Ampicillin | PMID:15048125 | Alternate plasmid names: pD40-His-c-Myc; pcDNA-DEST40 Myc wt This His6-tagged c-Myc plasmid was created by PCR amplification of the coding sequence for wild-type murine c-Myc2 from the CMVMyc plasmid (Hann et al., Genes Dev. 1994, PMID: 7958908) with a CACC 5′ extension added to the 5′ primer for cloning into the TOPO entry clone from Invitrogen (Carlsbad, CA). This sequence was then moved into the pDEST-40 mammalian expression vector using Gateway technology (Invitrogen), creating pD40-His-c-Myc. For plasmid usage information, see the associated article (Yeh et al. Nat Cell Biol. 2004) as well as Arnold et al. EMBO 2009 (PMID: 19131971). | Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 9 | |
|
pCRII-Topo Lpl in situ probe Resource Report Resource Website |
RRID:Addgene_45630 | Lpl in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Lpl fragment was amplified by RT-PCR using the following primer pair: TGCTGTGCAAAGAGAAGAGC CGGACACAAAGTTAGCACCA For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 3249-3900 of NM_008509.2, not bp# 3169-3826 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 3249-3900 of NM_008509.2 | 2026-08-15 01:15:25 | 0 |
|
pCRII-Topo Nectin-3 in situ probe Resource Report Resource Website |
RRID:Addgene_45633 | Nectin-3 in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Nectin-3 fragment was amplified by RT-PCR using the following primer pair: AAACAACCTGATCCGCAAAG CAGTGAAAACTGTAAAGCAGCTC For in vitro transcription, use the BamHI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1626-2039 of NM_021495, not bp# 1624-2036 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 1626-2039 of NM_021495 | 2026-08-15 01:15:25 | 0 |
|
pCRII-Topo Ptn in situ probe Resource Report Resource Website |
RRID:Addgene_45632 | Ptn in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Ptn fragment was amplified by RT-PCR using the following primer pair: GCCTACCCGTCCAAATATCC GCCAGTTCTGGTCTTCAAGG For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1241-1830 of NM_008973, not bp# 1238-1827 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 1241-1830 of NM_008973 | 2026-08-15 01:15:25 | 0 |
|
pCDNA3.1 AT1AR-TSTS/4A Resource Report Resource Website |
RRID:Addgene_45634 | AT1AR-TSTS/A | Rattus norvegicus | Ampicillin | PMID:15355986 | Mutant AT1A receptors were generated by mutagenesis PCR using pcDNA3.1-HA-AT1A receptor (provided by M. G. Caron, Duke University) as a template and a QuikChange multisite-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions. The primer for the TSTS/A receptor was: 5' p-CTCAAGCCTGTCTGCGAAAATGGCCGCTTGCTTACCGGCCTTC 3'. N4D mutation introduced to prevent glycosylation at this consensus site and steric hindrance of antibody binding. | Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA3.1/Zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Thr332, Ser335, Thr336, and Ser338 all changed to Alanine | 2026-08-15 01:15:25 | 0 |
|
pQuantEGFP-bsr-kana Resource Report Resource Website |
RRID:Addgene_45590 | Kanamycin | PMID:23892402 | Backbone Marker:Novagen; Vector Backbone:pET28; Vector Types:Cre/Lox, DT40 cell line targeting; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:25 | 0 | ||||
|
pQuantFLAG-hygro-kana Resource Report Resource Website |
RRID:Addgene_45591 | Kanamycin | PMID:23892402 | Backbone Marker:Novagen; Vector Backbone:pET28; Vector Types:Cre/Lox, DT40 cell line targeting; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:25 | 0 | ||||
|
pCRII-Topo Gp88 in situ probe Resource Report Resource Website |
RRID:Addgene_45628 | Gpr88 in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Gpr88 fragment was amplified by RT-PCR using the following primer pair: CAAATGAAACCAATGGTCAGG TATCTGTTTCCCGTGTCTCC For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 2742-3255 of AB042408.1 or bp# 2772-3285 of NM_022427, not bp# 2742-3255 of NM_022427 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 2742-3255 of AB042408.1 or bp# 2772-3285 of NM_022427 | 2026-08-15 01:15:25 | 0 |
|
pQuantA-hygro-kana Resource Report Resource Website |
RRID:Addgene_45585 | Kanamycin | PMID:23892402 | Backbone Marker:Novagen; Vector Backbone:pET28; Vector Types:Cre/Lox, DT40 cell line targeting; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:25 | 0 | ||||
|
pCRII-Topo Foxp2 in situ probe Resource Report Resource Website |
RRID:Addgene_45620 | Foxp2 in situ probe | Mus musculus | Ampicillin | PMID:16157277 | The Fox2p fragment was amplified by RT-PCR using the following primer pair: CAGTGTGGACTGTGGACGAA TTCCAGGTCCTCAGATAAAGG For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp#1709-2142 of AF339106, not bp# 1707-2142 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp#1709-2142 of AF339106 | 2026-08-15 01:15:25 | 0 |
|
pET28b-NpR5600 Resource Report Resource Website |
RRID:Addgene_45741 | NpR5600 | Nostoc punctiforme | Kanamycin | PMID:20813918 | Backbone Marker:Novagen; Backbone Size:5293; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:26 | 0 | ||
|
pQuantA-puro-kana Resource Report Resource Website |
RRID:Addgene_45586 | Kanamycin | PMID:23892402 | Backbone Marker:Novagen; Vector Backbone:pET28; Vector Types:Cre/Lox, DT40 cell line targeting; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:25 | 0 | ||||
|
pET29b-NpR5599 Resource Report Resource Website |
RRID:Addgene_45740 | NpR5599 | Nostoc punctiforme | Kanamycin | PMID:20813918 | Backbone Marker:Novagen; Backbone Size:5238; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:26 | 0 | ||
|
pQuantEGFP-puro-kana Resource Report Resource Website |
RRID:Addgene_45589 | Kanamycin | PMID:23892402 | Backbone Marker:Novagen; Vector Backbone:pET28; Vector Types:Cre/Lox, DT40 cell line targeting; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:25 | 0 | ||||
|
pCRII-Topo Tcrb-V13 in situ probe Resource Report Resource Website |
RRID:Addgene_45622 | Tcrb-V13 in situ probe | Mus musculus | Ampicillin | PMID:16157277 | The Tcrb-V13 fragment was amplified by RT-PCR using the following primer pair: CTGAGCTGGTGGGTGAATG AAGGTGTCAACGAGGAAGGA For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 533-1058 of X67128, not bp# 532-1059 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 533-1058 of X67128 | 2026-08-15 01:15:25 | 0 |
|
pET28b-Ava3855 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45743 | Ava3855 | Anabaena variabilis | Kanamycin | PMID:20813918 | Backbone Marker:Novagen; Backbone Size:5293; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:26 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
