Plasmids   Select Another Resource Report Type

http://www.addgene.org/188480

Genetic Insert: P-R-lox-TT-lox-catT172A
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188480 Copy   

•   Source: Addgene

http://www.addgene.org/188481

Genetic Insert: Ptet-Rtet-lox-TT-lox-tetA
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188481 Copy   

•   Source: Addgene

http://www.addgene.org/188477

Genetic Insert: P**-R-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188477 Copy   

•   Source: Addgene

http://www.addgene.org/188478

Genetic Insert: P-R*-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188478 Copy   

•   Source: Addgene

http://www.addgene.org/188479

Genetic Insert: P-R-lox-TT-lox-cat
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188479 Copy   

•   Source: Addgene

http://www.addgene.org/197655

Species: n/a
Genetic Insert: This strain is a derivative of BL21(DE3) with no specific assignment of the UAG codo
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:31243963
Comments: Derivative of BL21(DE3) with no specific assignment of the UAG codon - 95 endogenous TAG codons mutated to TAA - RF1 (prfA) deleted and fabR spontaneously mutated - serB deleted for phosphoserine genetic code expansion expression applications Primers for verification: - for RF1 (prfA) deletion: AAGCCTTCTATCGTTGCCAAAC, TTATTCCTGCTCGGACAACG - for serB deletion: AGTTTTGTGCGAGCCATCTTCCACC, GTGATGGTGTTCCAGGCATGACAGG This strain is used for expressing phosphoserine-containig proteins using genetic code expansion without buildup of prematurely truncated protein - Recommended plasmids for expressing phosphorylated proteins in this strain are Addgene #173897 (pSer GCE machinery vector) and #174075/174076 (compatible p15a origin of replication plasmids expressing sfGFP proteins from a T7 promoter; sfGFP genes can be removed by restriction digest and replaced with protein-of-interest). Original B95 strain: Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672

Proper citation: RRID:Addgene_197655 Copy   

•   Source: Addgene

http://www.addgene.org/215355

Genetic Insert: na
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38352175
Comments: Genotype: ATCC14048 + ∆dns + camR + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-9rfOeT70F35Li9CNjCnA?m=slm-n4lGsmu5T0KaunpiH620. Culture in LBv2 or LBv3 broth with 2ug/mL chloramphenicol. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_215355 Copy   

•   Source: Addgene

http://www.addgene.org/215356

Genetic Insert: na
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38352175
Comments: This is the NC1 strain (Addgene #215355) with a deletion of the camR gene. Genotype: ATCC14048 + ∆dns + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-HxxOFAiNbpHxSWT82Qju?m=slm-bQ5JkVI3VTiy0fDMPYr8. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_215356 Copy   

•   Source: Addgene

http://www.addgene.org/214746

Species: other
Genetic Insert: BBa_J23119-RiboJ-RBS(21992)-gfpmut3
Vector Backbone Description: Vector Backbone:colE1 ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386

Proper citation: RRID:Addgene_214746 Copy   

•   Source: Addgene

http://www.addgene.org/214747

Species: other
Genetic Insert: BBa_J23119-RBS(22821)-mcherry
Vector Backbone Description: Vector Backbone:pSC101 ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Comments: Please note: Plasmid contains three mutations in Rep101. These mutations are not known to affect plasmid function.

Proper citation: RRID:Addgene_214747 Copy   

•   Source: Addgene

http://www.addgene.org/214748

Species: other
Genetic Insert: BBa_J23119-RBS(22821)-mcherry
Vector Backbone Description: Vector Backbone:p15A ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Comments: Please note: Plasmid contains R334H and A76T mutations in glmS. These mutations are not known to affect plasmid function.

Proper citation: RRID:Addgene_214748 Copy   

•   Source: Addgene

http://www.addgene.org/220588

Species: n/a
Genetic Insert: exoI- recJ- araB::T7RNAP-tetA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:34949838
Comments: Strain was validated by shotgun sequencing using Illumina Nextseq. Supporting References: Bhattarai-Kline, S., Lear, S.K., Fishman, C.B. et al. Recording gene expression order in DNA by CRISPR addition of retron barcodes. Nature 608, 217–225 (2022). https://doi.org/10.1038/s41586-022-04994-6. González-Delgado A, Lopez SC, Rojas-Montero M, Fishman CB, Shipman SL. Simultaneous multi-site editing of individual genomes using retron arrays. bioRxiv [Preprint]. 2023 Jul 17:2023.07.17.549397. doi: 10.1101/2023.07.17.549397. PMID: 37503029; PMCID: PMC10370050.

Proper citation: RRID:Addgene_220588 Copy   

•   Source: Addgene

http://www.addgene.org/83308

Species: Mus musculus
Genetic Insert: FoxO1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None
Defining Citation: PMID:27511131
Comments: To construct pSELECT-HA-mFOXO1 the coding sequence of HA tag and FOXO1 were amplified from pCMV-HA-FOXO1 by PCR. The PCR product was digested with NheI and SalI restriction enzymes and inserted into the NheI and SalI sites of pSELECT-puro. The insert was sequenced and compared to mouse FOXO1 (NM_019739.3). Sequence identity was confirmed except for a conservative A->G mutation at base 474, a non-conservative A->G mutation at base 1121 and a non-conservative mutation T->C mutation at base 2321 of NM_019739.3. These mutations were confirmed to exist in the original pCMV-HA-FOXO1 plasmid. The non-conservative mutations result in a K->R substitution at amino acid 219 and a L->P substitution at amino acid 619 of mFOXO1 (NP_062713.2). Mutations at bases 1121 and 2321 were reversed to wild type by site-directed mutagenesis and the corrections were confirmed by sequencing

Proper citation: RRID:Addgene_83308 Copy   

•   Source: Addgene

http://www.addgene.org/78551

Genetic Insert: pTet--dCas9 cassette integrated at 186 primary attB site.
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:27060147

Proper citation: RRID:Addgene_78551 Copy   

•   Source: Addgene

http://www.addgene.org/176580

Genetic Insert: Strain
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag

Proper citation: RRID:Addgene_176580 Copy   

•   Source: Addgene

http://www.addgene.org/229546

Species: n/a
Genetic Insert: MG1655 attP21::PR-mCherry::frt proC::frt trpR::frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of trpR knock-out: Fwd - prEP184, gtatcactctctgctttattaccggcaa Rev - prEP186, gcggcaataatggtgtcgat Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.

Proper citation: RRID:Addgene_229546 Copy   

•   Source: Addgene

http://www.addgene.org/237425

Species: n/a
Genetic Insert: none
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40595632
Comments: Genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir, gyrAR462C To verify the gyrA gene using the following primers: gyrA462-F: cccgtcgtactattttcgaac gyrA462-R: cagcagtcggtcgataaagtc The expected PCR product size is approximately 600 bp. If the strain carries the two characteristic mutations (one silent mutation and one Arg→Cys substitution), it is the correct strain. Please see the GenBank file in the Supplementary Documents section above for reference. Note that the strain is only resistant to low levels of Trimethoprim and Streptomycin. Please see the .PDF in the Supplementary Documents section above. Addgene Note: This strain was prepared directly from the depositor's sample without further sequence verification. We recommend verifying the strain as described above. Please contact [email protected] if any issues arise.

Proper citation: RRID:Addgene_237425 Copy   

•   Source: Addgene

http://www.addgene.org/197656

Species: n/a
Genetic Insert: This strain is a derivative of BL21(DE3) with the serC gene knocked out
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:37122473
Comments: Strain is resistant to chloramphenicol. Derivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine. Primers for verification: - for serC deletion: CCTCAACGGTTTTACTCATTGCGATG, CGGGCAGATTAATAGTGCCATCGAC Additional reference: Rogerson et al. Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog. Nat Chem Biol. 2015 Jul;11(7):496-503 Please visit https://www.biorxiv.org/content/10.1101/2021.10.22.465468v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_197656 Copy   

•   Source: Addgene

http://www.addgene.org/200838

Species: Escherichia coli str. K-12 substr. MG1655
Genetic Insert: Genotype: MG1655 rph+, ilvG+, ΔlacZ, ΔrapZ, ΔglmZ, ΔglmY
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:36987877
Comments: Primer to check deletions: ΔrapZ (5' check primer: GGATACCGAAGGTACTCCGG; 3' check primer: CGTAAGAGCACTTCAGCGTC); ΔglmZ (5' check primer: GTGTAGGATCAAGCTCAGG; 3' check primer: CGGACGCCTACGATTACGC); ΔglmY (5' check primer: GTCTCTTTTTAGCGACACAGTGGC; 3' check primer: GGTGTTACTCTCGTCAGACGCG)

Proper citation: RRID:Addgene_200838 Copy   

•   Source: Addgene

http://www.addgene.org/197113

Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Comments: E. coli MEV15 is engineered to host diterpenoid biosynthetic pathways. Diterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase(s) and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Diterpenoid production can be induced by IPTG, vanillic acid, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and Streptomyces avermitilis ggps inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing.

Proper citation: RRID:Addgene_197113 Copy   

•   Source: Addgene