Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven luciferase miR-shRNA
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25760 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5303; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE
Proper citation: RRID:Addgene_25749 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE
Proper citation: RRID:Addgene_25748 Copy
Genetic Insert: UAS-hsp70 luciferase
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3415; Vector Backbone:pBluescript SK(-); Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:19481053
Proper citation: RRID:Addgene_21604 Copy
Vector Backbone Description: Backbone Marker:Ilya B. Tikh and James C. Samuelson1; Backbone Size:4366; Vector Backbone:pDEL; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35377874
Comments: - The destination strain should be recA+ and not be able to maintain R6K plasmid
- Gentamicin is used to select colonies with the integrated vector.
- The rhaBAD and lac promoters can be induced with 0.2% rhamnose and 0.5mM IPTG
Proper citation: RRID:Addgene_155361 Copy
Species: Homo sapiens
Genetic Insert: GIRK4
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34846128
Proper citation: RRID:Addgene_172427 Copy
Species: Homo sapiens
Genetic Insert: GIRK2
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34846128
Proper citation: RRID:Addgene_172426 Copy
Species: Homo sapiens
Genetic Insert: GIRK4
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34846128
Proper citation: RRID:Addgene_172425 Copy
Species: Homo sapiens
Genetic Insert: FIP200
Vector Backbone Description: Backbone Marker:Protech Facilities VBCF, Vienna, Austria; Backbone Size:2935; Vector Backbone:pGB-02-03; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34471133
Proper citation: RRID:Addgene_187832 Copy
Species: Oryzae sativa
Genetic Insert: ID#74
Vector Backbone Description: Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37248633
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_175929 Copy
Species: Brachypodium distachyon
Genetic Insert: ID#45
Vector Backbone Description: Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37248633
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_175920 Copy
Species: Brachypodium distachyon
Genetic Insert: ID#55
Vector Backbone Description: Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37248633
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_175921 Copy
Species: Brachypodium distachyon
Genetic Insert: ID#64
Vector Backbone Description: Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37248633
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_175922 Copy
Species: Oryzae sativa
Genetic Insert: ID#67
Vector Backbone Description: Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37248633
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_175923 Copy
Species: Oryzae sativa
Genetic Insert: ID#68
Vector Backbone Description: Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37248633
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_175924 Copy
Species: Oryzae sativa
Genetic Insert: ID#70
Vector Backbone Description: Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37248633
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_175925 Copy
Species: Medicago truncatula
Genetic Insert: ID#43
Vector Backbone Description: Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37248633
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_175917 Copy
Species: Medicago truncatula
Genetic Insert: ID#36
Vector Backbone Description: Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37248633
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_175911 Copy
Species: Medicago truncatula
Genetic Insert: ID#37
Vector Backbone Description: Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37248633
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_175912 Copy
Species: Medicago truncatula
Genetic Insert: ID#38
Vector Backbone Description: Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:37248633
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_175913 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
