Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942
Proper citation: RRID:Addgene_69783 Copy
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942
Proper citation: RRID:Addgene_69780 Copy
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942
Proper citation: RRID:Addgene_69784 Copy
Genetic Insert: MG1655 Z1 malE clpA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26900850
Comments: F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE-, clpA-
Proper citation: RRID:Addgene_65918 Copy
Genetic Insert: MG1655 Z1 malE aat
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26900850
Comments: F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE-, aat-
Proper citation: RRID:Addgene_65917 Copy
Genetic Insert: arabinose inducible lambda Red recombineering genes, rhamnose inducible flippase recombinase and m-toluic acid inducible I-SceI.
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26643270
Comments: E. coli K-12 MG1655 with genomically integrated arabinose inducible lambda Red recombineering genes, rhamnose inducible flippase recombinase and m-toluic acid inducible I-SceI.
Proper citation: RRID:Addgene_68246 Copy
Genetic Insert: Strain
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recB deletion verification:
Foward - tattttccagtcgtgaaagc
Reverse - ttgctgatttcttccatcag
Proper citation: RRID:Addgene_176580 Copy
Species: N/A
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:41529903
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-RiboJ-B0064-Pir4150-L3S3P21*)
Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.
Proper citation: RRID:Addgene_248174 Copy
Species: N/A
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:41529903
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, J23117-B0033-PirWT-L3S3P21*)
Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.
Proper citation: RRID:Addgene_248176 Copy
Species: Other
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:42199375
Comments: Genotype: E. coli B F- ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS) ΔendA ΔrecA glvC ::[ phlFAM, cymRAM, luxR, vanRAM, lacIAM, tetR ]
Fast growth at 37C in LB (doubling time ~ 20-25 minutes) and improved DNA (endA, recA) and protein stability (lon, ompT).
Strain validation:
- PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 5 518 bp.
- PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1160(GCTTGTCGACGACGGC) generates a product of 140 bp.
- PCR using OR1157 (TACCCCAGTTGGGGCAC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 110 bp. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.
Proper citation: RRID:Addgene_235121 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt ilvA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
ilvA_fwd: ATCGTGAACGTCAGGTCTCC
ilvA_rev: TCTGGAAGATTTTGCCGAAC
Proper citation: RRID:Addgene_230042 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt ilvA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
ilvA_fwd: ATCGTGAACGTCAGGTCTCC
ilvA_rev: TCTGGAAGATTTTGCCGAAC
Proper citation: RRID:Addgene_230041 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt metA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
metA_fwd: CGTGAGCGGCGAATACTAAT
metA_rev: AAACTTCCCCACTGTGAAC
Proper citation: RRID:Addgene_230040 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt proC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
proC_fwd: CATAAAGTCATCCTTTGTTGGG
proC_rev: CTTTACGGATTAGTGTGGGG
Proper citation: RRID:Addgene_230035 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt metA::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:37903278
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
metA_fwd: CGTGAGCGGCGAATACTAAT
metA_rev: AAACTTCCCCACTGTGAAC
Proper citation: RRID:Addgene_230039 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt proC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
proC_fwd: CATAAAGTCATCCTTTGTTGGG
proC_rev: CTTTACGGATTAGTGTGGGG
Proper citation: RRID:Addgene_230036 Copy
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq integrated at intS
Proper citation: RRID:Addgene_60368 Copy
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq intergrated at intS + Δ hfq
Proper citation: RRID:Addgene_60369 Copy
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq intergrated at intS + Δ hfq + Δ dsrA
Proper citation: RRID:Addgene_60373 Copy
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:22833608
Comments: HL1745 + PLlacO-1::T710::yfp intergrated at galK+ ∆lacI
Proper citation: RRID:Addgene_61163 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
