Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: bacteria
Genetic Insert: Promotorless gfp reporter gene
Vector Backbone Description: Vector Backbone:pBBR1; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:11059491
Comments: Please refer to the attached table for a complete list of restriction sites in the MCS.
Proper citation: RRID:Addgene_37821 Copy
Species: Homo sapiens
Genetic Insert: P53 gene
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:33263541
Proper citation: RRID:Addgene_174042 Copy
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31092918
Comments: The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames.
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
Proper citation: RRID:Addgene_174513 Copy
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34083482
Comments: From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514).
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
Genotyping for deletion of serU gene:
GE1147 TACGAATGATGCCTCGCCGCAAATAAG
GE1148 CCTCACGCAACGGAATAAAGGGAACTC
Genotyping for deletion of serT gene:
GE1215 AGCGTCAGGCTCAGCAGAAAATAGG
GE1216 ACGTCCCTGTAGCAAGGCAAACCATC
Genotyping for deletion of prfA gene:
v13-1011 GACTAACCGCTTGATCCATGCGC
v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC
Proper citation: RRID:Addgene_174514 Copy
Species: Escherichia coli
Genetic Insert: phosphoglycerate kinase
Vector Backbone Description: Backbone Size:3810; Vector Backbone:pCDM4; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23361000
Proper citation: RRID:Addgene_49808 Copy
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:22822084
Comments: selection using 10-15 micrograms/mL strep.
It is MalE deficient, which enables maltose complementation. For the assay, a particular construct is transformed into MM39 and grown on maltose minimal media to confirm proper membrane orientation and integration.
Proper citation: RRID:Addgene_42894 Copy
Species: Other
Genetic Insert: mRFP
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25422271
Proper citation: RRID:Addgene_62249 Copy
Species: E. coli
Genetic Insert: PBM3R1-YFP
Vector Backbone Description: Backbone Marker:Alec Nielsen; Backbone Size:3359; Vector Backbone:pAN4020; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27034378
Proper citation: RRID:Addgene_74701 Copy
Species: E. coli
Genetic Insert: PPhlF-PBetI-YFP
Vector Backbone Description: Backbone Marker:Alec Nielsen; Backbone Size:3359; Vector Backbone:pAN4020; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27034378
Proper citation: RRID:Addgene_74703 Copy
Species: Acetobacter aceti 1023
Genetic Insert: hypothetical protein in purSQL operon
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Comments: pCloDF13 replicon
Contains additional (repeated?) sequence in 3' UTR of cassette 1.
Proper citation: RRID:Addgene_72522 Copy
Species: Acetobacter aceti 1023
Genetic Insert: N5-carboxyaminoimidazole ribonucleotide mutase
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_72453 Copy
Species: Acetobacter aceti 1023
Genetic Insert: N5-carboxyaminoimidazole ribonucleotide mutase
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_72451 Copy
Species: Homo sapiens
Genetic Insert: SUMO-2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52259 Copy
Species: Homo sapiens
Genetic Insert: SUMO-3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52260 Copy
Species: Homo sapiens
Genetic Insert: SUMO-2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52262 Copy
Species: Synthetic
Genetic Insert: ΔrecA
Vector Backbone Description: Vector Backbone:N.A.; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36922599
Comments: Details of construction, use, and characterization are available in
Nyerges A, Vinke S, Flynn R, Owen SV, Rand EA, Budnik B, Keen E, Narasimhan K, Marchand JA, Baas-Thomas M, Liu M, Chen K, Chiappino-Pepe A, Hu F, Baym M, Church GM (2022) Swapped genetic code blocks viral infections and gene transfer, https://doi.org/10.1101/2022.07.08.499367
https://www.biorxiv.org/content/10.1101/2022.07.08.499367v1.full
Proper citation: RRID:Addgene_189857 Copy
Genetic Insert: cytidine base editing; oriV(pRO1600/ColE1), xylS, Pm→repA, P14b→msfGFP; Pm→CBE:SpRY, PEM7→non-specific sgRNA
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826
Proper citation: RRID:Addgene_207530 Copy
Species: Synthetic
Genetic Insert: 35s:TMVΩ:CUP2:GAl4:nos
Vector Backbone Description: Vector Backbone:pDGB3_omega1; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37032497
Comments: + CBSmin35s:AAtrΔ11:35s + CBSmin35s: ATF1-2:mas + CBSmin35s:HarFar:g7
Please visit https://www.biorxiv.org/content/10.1101/2022.06.15.496242 for bioRxiv preprint.
Proper citation: RRID:Addgene_187605 Copy
Species: Xenorhabdus bovienii SS-2004
Genetic Insert: Leupeptin Protease Inhibitor Pathway
Vector Backbone Description: Backbone Marker:Novagen (EMD Millipore); Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34581573
Proper citation: RRID:Addgene_213154 Copy
Vector Backbone Description: Backbone Size:5267; Vector Backbone:CloDF13; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39126322
Proper citation: RRID:Addgene_213133 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
