Plasmids   Select Another Resource Report Type

http://www.addgene.org/215355

Genetic Insert: na
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38352175
Comments: Genotype: ATCC14048 + ∆dns + camR + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-9rfOeT70F35Li9CNjCnA?m=slm-n4lGsmu5T0KaunpiH620. Culture in LBv2 or LBv3 broth with 2ug/mL chloramphenicol. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_215355 Copy   

•   Source: Addgene
  

http://www.addgene.org/215356

Genetic Insert: na
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38352175
Comments: This is the NC1 strain (Addgene #215355) with a deletion of the camR gene. Genotype: ATCC14048 + ∆dns + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-HxxOFAiNbpHxSWT82Qju?m=slm-bQ5JkVI3VTiy0fDMPYr8. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_215356 Copy   

•   Source: Addgene
  

http://www.addgene.org/197113

Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Comments: E. coli MEV15 is engineered to host diterpenoid biosynthetic pathways. Diterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase(s) and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Diterpenoid production can be induced by IPTG, vanillic acid, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and Streptomyces avermitilis ggps inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing.

Proper citation: RRID:Addgene_197113 Copy   

•   Source: Addgene
  

http://www.addgene.org/200838

Species: Escherichia coli str. K-12 substr. MG1655
Genetic Insert: Genotype: MG1655 rph+, ilvG+, ΔlacZ, ΔrapZ, ΔglmZ, ΔglmY
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:36987877
Comments: Primer to check deletions: ΔrapZ (5' check primer: GGATACCGAAGGTACTCCGG; 3' check primer: CGTAAGAGCACTTCAGCGTC); ΔglmZ (5' check primer: GTGTAGGATCAAGCTCAGG; 3' check primer: CGGACGCCTACGATTACGC); ΔglmY (5' check primer: GTCTCTTTTTAGCGACACAGTGGC; 3' check primer: GGTGTTACTCTCGTCAGACGCG)

Proper citation: RRID:Addgene_200838 Copy   

•   Source: Addgene
  

http://www.addgene.org/205015

Species: E. coli
Genetic Insert: ΔtnaA ΔtrpR
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35594503
Comments: Primers for PCR verification: veri-trpR-F: AGCAGCTTATAACGCCGGACCAGGG veri-trpR-R: TGGTCCCGTGATGTCGCGTTATAC veri-tnaA-F: CTTGTTTTAGTAAATGATGGTGCTTG veri-tnaA-R: GATCAGTCATGATGCCACCTTTAGAG

Proper citation: RRID:Addgene_205015 Copy   

•   Source: Addgene
  

http://www.addgene.org/60368

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq integrated at intS

Proper citation: RRID:Addgene_60368 Copy   

•   Source: Addgene
  

http://www.addgene.org/60369

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq intergrated at intS + Δ hfq

Proper citation: RRID:Addgene_60369 Copy   

•   Source: Addgene
  

http://www.addgene.org/60373

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq intergrated at intS + Δ hfq + Δ dsrA

Proper citation: RRID:Addgene_60373 Copy   

•   Source: Addgene
  

http://www.addgene.org/61163

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:22833608
Comments: HL1745 + PLlacO-1::T710::yfp intergrated at galK+ ∆lacI

Proper citation: RRID:Addgene_61163 Copy   

•   Source: Addgene
  

http://www.addgene.org/61160

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:22833608
Comments: MG1655 + PLlacO-1::T710::cfp intergrated at intS

Proper citation: RRID:Addgene_61160 Copy   

•   Source: Addgene
  

http://www.addgene.org/61164

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:22833608
Comments: MG1655 + PLlacO-1::T710::yfp intergrated at arpB + ∆lacI

Proper citation: RRID:Addgene_61164 Copy   

•   Source: Addgene
  

http://www.addgene.org/61440

Vector Backbone Description: Backbone Size:4600000; Vector Backbone:E. coli K-12 MG1655 genome; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:25076127
Comments: This strain carries the DE3 lysogen.

Proper citation: RRID:Addgene_61440 Copy   

•   Source: Addgene
  

http://www.addgene.org/61911

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = tyrA Precursor strain = C43(DE3) modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Tyr) Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61911 Copy   

•   Source: Addgene
  

http://www.addgene.org/61912

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = glnA Precursor strain = C43(DE3) modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = Gln Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61912 Copy   

•   Source: Addgene
  

http://www.addgene.org/61919

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = cyo ilvE avtA aspC hisG metA Precursor strain = ML23 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Met *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61919 Copy   

•   Source: Addgene
  

http://www.addgene.org/61915

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = cyo ilvE avtA aspC hisG asnA Precursor strain = ML23 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61915 Copy   

•   Source: Addgene
  

http://www.addgene.org/61916

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = cyo ilvE avtA aspC hisG asnA asnB Precursor strain = ML24 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Asn *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61916 Copy   

•   Source: Addgene
  

http://www.addgene.org/61921

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = cyo ilvE avtA aspC hisG argH metA lysA thrC asnB Precursor strain = ML41 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg, Met, Lys, Thr *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61921 Copy   

•   Source: Addgene
  

http://www.addgene.org/61961

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = metA Precursor strain = C43(DE3) Selective amino acid labeling (and/or requirement) = Met Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_61961 Copy   

•   Source: Addgene
  

http://www.addgene.org/62070

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = thrC Precursor strain = BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Thr Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62070 Copy   

•   Source: Addgene