Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:gentamicin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

783 Results - per page

Show More Columns | Download 783 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pEN_TmiR_Luc-A
 
Resource Report
Resource Website 		RRID:Addgene_25760 Luciferase miR-shRNA Gentamicin PMID:16945906 Entry vector with TRE-driven luciferase miR-shRNA Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:12:45 0
pEN_TGmiRc3
 
Resource Report
Resource Website 		RRID:Addgene_25749 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE Backbone Marker:ATCC 10326362; Backbone Size:5303; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:12:45 0
pEN_TmiRc3
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_25748 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:12:45 12
pUAS-Luc
 
Resource Report
Resource Website 		RRID:Addgene_21604 UAS-hsp70 luciferase Gentamicin PMID:19481053 Backbone Marker:Stratagene; Backbone Size:3415; Vector Backbone:pBluescript SK(-); Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:12:03 0
pOD_004
 
Resource Report
Resource Website 		RRID:Addgene_155361 Gentamicin PMID:35377874 - The destination strain should be recA+ and not be able to maintain R6K plasmid - Gentamicin is used to select colonies with the integrated vector. - The rhaBAD and lac promoters can be induced with 0.2% rhamnose and 0.5mM IPTG Backbone Marker:Ilya B. Tikh and James C. Samuelson1; Backbone Size:4366; Vector Backbone:pDEL; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin 2026-08-15 01:23:52 0
pACE-GIRK4-mC-S
 
Resource Report
Resource Website 		RRID:Addgene_172427 GIRK4 Homo sapiens Gentamicin PMID:34846128 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:23:57 0
pACE-GIRK2-S
 
Resource Report
Resource Website 		RRID:Addgene_172426 GIRK2 Homo sapiens Gentamicin PMID:34846128 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:23:59 0
pACE-GIRK4-S
 
Resource Report
Resource Website 		RRID:Addgene_172425 GIRK4 Homo sapiens Gentamicin PMID:34846128 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:23:57 0
GST-3C-FIP200-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_187832 FIP200 Homo sapiens Gentamicin PMID:34471133 Backbone Marker:Protech Facilities VBCF, Vienna, Austria; Backbone Size:2935; Vector Backbone:pGB-02-03; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:24:01 1
pDL226
 
Resource Report
Resource Website 		RRID:Addgene_175929 ID#74 Oryzae sativa Gentamicin PMID:37248633 Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint. Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:24:03 0
pDL156
 
Resource Report
Resource Website 		RRID:Addgene_175920 ID#45 Brachypodium distachyon Gentamicin PMID:37248633 Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint. Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:24:03 0
pDL217
 
Resource Report
Resource Website 		RRID:Addgene_175921 ID#55 Brachypodium distachyon Gentamicin PMID:37248633 Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint. Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:24:03 0
pDL216
 
Resource Report
Resource Website 		RRID:Addgene_175922 ID#64 Brachypodium distachyon Gentamicin PMID:37248633 Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint. Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:24:03 0
pDL214
 
Resource Report
Resource Website 		RRID:Addgene_175923 ID#67 Oryzae sativa Gentamicin PMID:37248633 Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint. Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:24:03 0
pDL202
 
Resource Report
Resource Website 		RRID:Addgene_175924 ID#68 Oryzae sativa Gentamicin PMID:37248633 Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint. Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:24:03 0
pDL215
 
Resource Report
Resource Website 		RRID:Addgene_175925 ID#70 Oryzae sativa Gentamicin PMID:37248633 Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint. Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:24:03 0
pDL112
 
Resource Report
Resource Website 		RRID:Addgene_175917 ID#43 Medicago truncatula Gentamicin PMID:37248633 Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint. Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:24:03 0
pDL106
 
Resource Report
Resource Website 		RRID:Addgene_175911 ID#36 Medicago truncatula Gentamicin PMID:37248633 Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint. Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:24:03 0
pDL107
 
Resource Report
Resource Website 		RRID:Addgene_175912 ID#37 Medicago truncatula Gentamicin PMID:37248633 Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint. Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:24:03 0
pDL108
 
Resource Report
Resource Website 		RRID:Addgene_175913 ID#38 Medicago truncatula Gentamicin PMID:37248633 Please visit https://www.biorxiv.org/content/10.1101/2021.08.23.457316v2 for bioRxiv preprint. Vector Backbone:pDONOR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-08-15 01:24:03 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch