Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:gentamicin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

790 Results - per page

Show More Columns | Download 790 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pACEBac1-GCP5
 
Resource Report
Resource Website 		RRID:Addgene_178071 GCP5 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:29:10 0
pACEBac1-GCP6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178072 GCP6 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:29:10 1
pACEBac1-gamma-tubulin(N229A)-TEV-His6
 
Resource Report
Resource Website 		RRID:Addgene_178077 gamma-tubulin with an N229A point mutation Homo sapiens Gentamicin PMID:33496729 Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Changed Asparagine 229 to Alanine Addgene 2026-09-26 02:29:10 0
pACEBac1-MZT1
 
Resource Report
Resource Website 		RRID:Addgene_178075 MZT1 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:29:10 0
pACEBac1-beta-actin
 
Resource Report
Resource Website 		RRID:Addgene_178076 beta-actin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:29:10 0
pACEBac1-gamma-tubulin-TEV-His6
 
Resource Report
Resource Website 		RRID:Addgene_178067 gamma-tubulin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:29:10 0
BASIC_SEVA_67.10
 
Resource Report
Resource Website 		RRID:Addgene_178940 mScarlet counter-selection cassette Synthetic Gentamicin PMID:36381610 Cloning method: BASIC DNA assembly . Please visit https://www.biorxiv.org/content/10.1101/2022.01.06.446575v2 for bioRxiv preprint. Backbone Size:2607; Vector Backbone:BASIC_SEVA_67.10; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:29:17 0
pDON207 NSP3 K977Q
 
Resource Report
Resource Website 		RRID:Addgene_180057 SARS-CoV-2 NSP3 K977Q SARS-CoV-2 Gentamicin PMID:34709727 Vector Backbone:pDON207; Vector Types:Mammalian Expression; Bacterial Resistance:Gentamicin NSP3 K977Q Addgene 2026-09-26 02:29:21 0
pLX-TRV1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_180515 Tobacco rattle virus RNA1 Gentamicin PMID:35332696 Vector Backbone:pLX-Z4; Vector Types:Plant Expression; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:29:23 1
pEN_hU6miR-Gb2-K
 
Resource Report
Resource Website 		RRID:Addgene_25759 Gb2 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with U6-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:30:44 0
pEN_TTmcs
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_25755 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT Backbone Marker:ATCC 10326362; Backbone Size:4218; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:30:44 19
pEN_hU6miR-G12-E
 
Resource Report
Resource Website 		RRID:Addgene_25757 G alpha 12 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with U6-driven G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Addgene sequence shows that this plasmid is missing the EcoRI site. Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:30:44 0
pEN_TTmiRc2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25752 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT Backbone Marker:ATCC 10326362; Backbone Size:4422; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:30:44 6
pEN_Tmcs
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25751 Gentamicin PMID:16945906 TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple cloning sites d/s of TRE Backbone Marker:ATCC 10326362; Backbone Size:4347; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:30:44 6
pEN_TRE_GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25767 Gentamicin PMID:16945906 Entry vector with TRE-driven GFP Backbone Marker:ATCC 10326362; Backbone Size:4655; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:30:44 1
pEN_TmiR_G13-L_G12-E
 
Resource Report
Resource Website 		RRID:Addgene_25763 G alpha 13 and 12 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function. Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:30:44 0
pEN_TmiR_G13-L
 
Resource Report
Resource Website 		RRID:Addgene_25762 G alpha 13 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT Addgene sequence shows that this plasmid is missing the SpeI site. Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:30:44 0
pEN_TGmiR_Luc-A
 
Resource Report
Resource Website 		RRID:Addgene_25765 Luciferase miR-shRNA Gentamicin PMID:16945906 Entry vector with TRE-driven luciferase miR-shRNA and co-expressed GFP Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:30:44 0
pEN_TmiR_Gb2-K
 
Resource Report
Resource Website 		RRID:Addgene_25764 Gb2 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Addgene sequence shows that this plasmid is missing the SpeI site. Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:30:44 0
pEN_TmiR_Luc-A
 
Resource Report
Resource Website 		RRID:Addgene_25760 Luciferase miR-shRNA Gentamicin PMID:16945906 Entry vector with TRE-driven luciferase miR-shRNA Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-26 02:30:44 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch