Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
MG1655-OptoCre-cat-T172A-P-R Resource Report Resource Website |
RRID:Addgene_188480 | P-R-lox-TT-lox-catT172A | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:25:09 | 0 | ||
|
MG1655-OptoCre-tetA-Ptet-Rtet Resource Report Resource Website |
RRID:Addgene_188481 | Ptet-Rtet-lox-TT-lox-tetA | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:25:12 | 0 | ||
|
MG1655-OptoCre-knt-P**-R Resource Report Resource Website |
RRID:Addgene_188477 | P**-R-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:25:09 | 0 | ||
|
MG1655-OptoCre-knt-P-R* Resource Report Resource Website |
RRID:Addgene_188478 | P-R*-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:25:12 | 0 | ||
|
MG1655-OptoCre-cat-P-R Resource Report Resource Website |
RRID:Addgene_188479 | P-R-lox-TT-lox-cat | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:25:09 | 0 | ||
|
B95(DE3) ΔA ΔfabR ΔserB Resource Report Resource Website 1+ mentions |
RRID:Addgene_197655 | This strain is a derivative of BL21(DE3) with no specific assignment of the UAG codo | n/a | None | PMID:31243963 | Derivative of BL21(DE3) with no specific assignment of the UAG codon - 95 endogenous TAG codons mutated to TAA - RF1 (prfA) deleted and fabR spontaneously mutated - serB deleted for phosphoserine genetic code expansion expression applications Primers for verification: - for RF1 (prfA) deletion: AAGCCTTCTATCGTTGCCAAAC, TTATTCCTGCTCGGACAACG - for serB deletion: AGTTTTGTGCGAGCCATCTTCCACC, GTGATGGTGTTCCAGGCATGACAGG This strain is used for expressing phosphoserine-containig proteins using genetic code expansion without buildup of prematurely truncated protein - Recommended plasmids for expressing phosphorylated proteins in this strain are Addgene #173897 (pSer GCE machinery vector) and #174075/174076 (compatible p15a origin of replication plasmids expressing sfGFP proteins from a T7 promoter; sfGFP genes can be removed by restriction digest and replaced with protein-of-interest). Original B95 strain: Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672 | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:26:00 | 2 | |
|
V. natriegens NC1 Resource Report Resource Website |
RRID:Addgene_215355 | na | None | PMID:38352175 | Genotype: ATCC14048 + ∆dns + camR + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-9rfOeT70F35Li9CNjCnA?m=slm-n4lGsmu5T0KaunpiH620. Culture in LBv2 or LBv3 broth with 2ug/mL chloramphenicol. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint. | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:29:03 | 0 | ||
|
V. natriegens NC7 Resource Report Resource Website |
RRID:Addgene_215356 | na | None | PMID:38352175 | This is the NC1 strain (Addgene #215355) with a deletion of the camR gene. Genotype: ATCC14048 + ∆dns + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-HxxOFAiNbpHxSWT82Qju?m=slm-bQ5JkVI3VTiy0fDMPYr8. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint. | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:29:03 | 0 | ||
|
pMBA334 Resource Report Resource Website |
RRID:Addgene_214746 | BBa_J23119-RiboJ-RBS(21992)-gfpmut3 | other | None | PMID:38086386 | Vector Backbone:colE1 ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2026-08-15 01:29:49 | 0 | ||
|
pMBA327 Resource Report Resource Website |
RRID:Addgene_214747 | BBa_J23119-RBS(22821)-mcherry | other | None | PMID:38086386 | Please note: Plasmid contains three mutations in Rep101. These mutations are not known to affect plasmid function. | Vector Backbone:pSC101 ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2026-08-15 01:29:49 | 0 | |
|
pMBA328 Resource Report Resource Website |
RRID:Addgene_214748 | BBa_J23119-RBS(22821)-mcherry | other | None | PMID:38086386 | Please note: Plasmid contains R334H and A76T mutations in glmS. These mutations are not known to affect plasmid function. | Vector Backbone:p15A ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2026-08-15 01:29:50 | 0 | |
|
bMS.346 Resource Report Resource Website 1+ mentions |
RRID:Addgene_220588 | exoI- recJ- araB::T7RNAP-tetA | n/a | None | PMID:34949838 | Strain was validated by shotgun sequencing using Illumina Nextseq. Supporting References: Bhattarai-Kline, S., Lear, S.K., Fishman, C.B. et al. Recording gene expression order in DNA by CRISPR addition of retron barcodes. Nature 608, 217–225 (2022). https://doi.org/10.1038/s41586-022-04994-6. González-Delgado A, Lopez SC, Rojas-Montero M, Fishman CB, Shipman SL. Simultaneous multi-site editing of individual genomes using retron arrays. bioRxiv [Preprint]. 2023 Jul 17:2023.07.17.549397. doi: 10.1101/2023.07.17.549397. PMID: 37503029; PMCID: PMC10370050. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:30:07 | 1 | |
|
pSELECT-HA-mFOXO1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83308 | FoxO1 | Mus musculus | None | PMID:27511131 | To construct pSELECT-HA-mFOXO1 the coding sequence of HA tag and FOXO1 were amplified from pCMV-HA-FOXO1 by PCR. The PCR product was digested with NheI and SalI restriction enzymes and inserted into the NheI and SalI sites of pSELECT-puro. The insert was sequenced and compared to mouse FOXO1 (NM_019739.3). Sequence identity was confirmed except for a conservative A->G mutation at base 474, a non-conservative A->G mutation at base 1121 and a non-conservative mutation T->C mutation at base 2321 of NM_019739.3. These mutations were confirmed to exist in the original pCMV-HA-FOXO1 plasmid. The non-conservative mutations result in a K->R substitution at amino acid 219 and a L->P substitution at amino acid 619 of mFOXO1 (NP_062713.2). Mutations at bases 1121 and 2321 were reversed to wild type by site-directed mutagenesis and the corrections were confirmed by sequencing | Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None | 2026-08-15 01:21:06 | 1 | |
|
LC-E02 Resource Report Resource Website |
RRID:Addgene_78551 | pTet--dCas9 cassette integrated at 186 primary attB site. | None | PMID:27060147 | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | This is a bacterial strain | 2026-08-15 01:20:24 | 0 | ||
|
BL21 ΔrecB Resource Report Resource Website |
RRID:Addgene_176580 | Strain | None | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None | recB genomic deletion | 2026-08-15 01:11:00 | 0 | |
|
TB205 △proC △trpR Resource Report Resource Website |
RRID:Addgene_229546 | MG1655 attP21::PR-mCherry::frt proC::frt trpR::frt | n/a | None | PMID:40509754 | Primers for sequence verification of trpR knock-out: Fwd - prEP184, gtatcactctctgctttattaccggcaa Rev - prEP186, gcggcaataatggtgtcgat Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:33:02 | 0 | |
|
S17-1λpir gyrAR462C Resource Report Resource Website |
RRID:Addgene_237425 | none | n/a | None | PMID:40595632 | Genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir, gyrAR462C To verify the gyrA gene using the following primers: gyrA462-F: cccgtcgtactattttcgaac gyrA462-R: cagcagtcggtcgataaagtc The expected PCR product size is approximately 600 bp. If the strain carries the two characteristic mutations (one silent mutation and one Arg→Cys substitution), it is the correct strain. Please see the GenBank file in the Supplementary Documents section above for reference. Note that the strain is only resistant to low levels of Trimethoprim and Streptomycin. Please see the .PDF in the Supplementary Documents section above. Addgene Note: This strain was prepared directly from the depositor's sample without further sequence verification. We recommend verifying the strain as described above. Please contact [email protected] if any issues arise. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:33:40 | 0 | |
|
BL21(DE3) ΔserC Resource Report Resource Website 1+ mentions |
RRID:Addgene_197656 | This strain is a derivative of BL21(DE3) with the serC gene knocked out | n/a | None | PMID:37122473 | Strain is resistant to chloramphenicol. Derivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine. Primers for verification: - for serC deletion: CCTCAACGGTTTTACTCATTGCGATG, CGGGCAGATTAATAGTGCCATCGAC Additional reference: Rogerson et al. Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog. Nat Chem Biol. 2015 Jul;11(7):496-503 Please visit https://www.biorxiv.org/content/10.1101/2021.10.22.465468v2 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:26:15 | 1 | |
|
Z956 Resource Report Resource Website |
RRID:Addgene_200838 | Genotype: MG1655 rph+, ilvG+, ΔlacZ, ΔrapZ, ΔglmZ, ΔglmY | Escherichia coli str. K-12 substr. MG1655 | None | PMID:36987877 | Primer to check deletions: ΔrapZ (5' check primer: GGATACCGAAGGTACTCCGG; 3' check primer: CGTAAGAGCACTTCAGCGTC); ΔglmZ (5' check primer: GTGTAGGATCAAGCTCAGG; 3' check primer: CGGACGCCTACGATTACGC); ΔglmY (5' check primer: GTCTCTTTTTAGCGACACAGTGGC; 3' check primer: GGTGTTACTCTCGTCAGACGCG) | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | rapZ, glmZ and glmY are deleted to avoid interference with plasmid-encoded genes | 2026-08-15 01:27:15 | 0 |
|
E. coli MEV20 Resource Report Resource Website |
RRID:Addgene_197113 | None | E. coli MEV15 is engineered to host diterpenoid biosynthetic pathways. Diterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase(s) and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Diterpenoid production can be induced by IPTG, vanillic acid, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and Streptomyces avermitilis ggps inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:27:00 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
