Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:none (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

199 Results - per page

Show More Columns | Download 199 Result(s)

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Authority Record Last Update Mentions Count
HL 6779
 
Resource Report
Resource Website
RRID:Addgene_69783 None PMID:27084942 Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None Addgene 2026-09-26 02:37:15 0
HL 6776
 
Resource Report
Resource Website
RRID:Addgene_69780 None PMID:27084942 Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None Addgene 2026-09-26 02:37:15 0
HL 6825
 
Resource Report
Resource Website
RRID:Addgene_69784 None PMID:27084942 Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None Addgene 2026-09-26 02:37:15 0
CY008
 
Resource Report
Resource Website
RRID:Addgene_72401 None PMID:26315440 No antibiotic resistance. Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:37:39 0
LC-E02
 
Resource Report
Resource Website
RRID:Addgene_78551 pTet--dCas9 cassette integrated at 186 primary attB site. None PMID:27060147 Vector Backbone:na; Vector Types:; Bacterial Resistance:None This is a bacterial strain Addgene 2026-09-26 02:38:41 0
pSELECT-HA-mFOXO1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_83308 FoxO1 Mus musculus None PMID:27511131 To construct pSELECT-HA-mFOXO1 the coding sequence of HA tag and FOXO1 were amplified from pCMV-HA-FOXO1 by PCR. The PCR product was digested with NheI and SalI restriction enzymes and inserted into the NheI and SalI sites of pSELECT-puro. The insert was sequenced and compared to mouse FOXO1 (NM_019739.3). Sequence identity was confirmed except for a conservative A->G mutation at base 474, a non-conservative A->G mutation at base 1121 and a non-conservative mutation T->C mutation at base 2321 of NM_019739.3. These mutations were confirmed to exist in the original pCMV-HA-FOXO1 plasmid. The non-conservative mutations result in a K->R substitution at amino acid 219 and a L->P substitution at amino acid 619 of mFOXO1 (NP_062713.2). Mutations at bases 1121 and 2321 were reversed to wild type by site-directed mutagenesis and the corrections were confirmed by sequencing Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None Addgene 2026-09-26 02:39:27 1
JEC027
 
Resource Report
Resource Website
RRID:Addgene_180310 None PMID:35077145 Genotype: E. coli MG1655ΔCRISPR-Cas Method: Knockout using pKD46/pKD4 Created by: Baiyang Liu Knockout region from MG1655 genome: 995605 to 1006007 Primer Fw: GATTATCGACTGGGATAACC Primer Rv: CAGAAATATTCGACAAAGCG Expected PCR size for JEC027: 1kb Expected PCR size for MG1655: 10.4kb Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:41:26 0
KTD101(DE3)
 
Resource Report
Resource Website
RRID:Addgene_138651 None E. coli None PMID:31772280 Genotype: λDE3 Δtig100 Δ(araD–araB)567 ΔlacZ4787(::rrnB-3) lacIP-4000(lacIQ) rph-1 Δ(rhaD–rhaB)568 hsdR514 KTD101(DE3) is a λDE3 derivative of the trigger factor deficient (Δtig) strain KTD101 from Puertas et al 2010 Protein Expression and Purification 74: 122–128, PMID 20600941. Puertas et al 2010 showed that deletion of trigger factor in the parent strain KTD101 increased the level of secreted recombinantly expressed protein. This strain may also improve the level of protein expression in the periplasm and in the outer membrane. This derivative strain KTD101(DE3) now allows expression that is based on the widely-used T7 promoter. The parent strain KTD101 was provided by François Baneyx at the University of Washington. DE3 lysogenization is apparent from positive expression that was obtained for the BBA57 protein upon expression from the T7 promoter plasmid pBBA57-TEV-His12, as was shown in Figure S5C, lane 7, of Robertson et al, Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x. Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:41:39 0
BA14
 
Resource Report
Resource Website
RRID:Addgene_186997 bglR, thi-1, rel-1 HfrPO1, ∆nuoA-N E. coli None PMID:16979134 Parent strain is 1100, from Humbert et al. 1983 J Bacteriol. doi.org/10.1128/jb.153.1.416-422.1983 Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:42:29 0
MG1655-OptoCre-cat-T172A-P-R
 
Resource Report
Resource Website
RRID:Addgene_188480 P-R-lox-TT-lox-catT172A None PMID:36823420 Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:43:38 0
MG1655-OptoCre-tetA-Ptet-Rtet
 
Resource Report
Resource Website
RRID:Addgene_188481 Ptet-Rtet-lox-TT-lox-tetA None PMID:36823420 Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:43:38 0
MG1655-OptoCre-knt-P**-R
 
Resource Report
Resource Website
RRID:Addgene_188477 P**-R-lox-TT-lox-knt None PMID:36823420 Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:43:38 0
MG1655-OptoCre-knt-P-R*
 
Resource Report
Resource Website
RRID:Addgene_188478 P-R*-lox-TT-lox-knt None PMID:36823420 Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:43:38 0
MG1655-OptoCre-cat-P-R
 
Resource Report
Resource Website
RRID:Addgene_188479 P-R-lox-TT-lox-cat None PMID:36823420 Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:43:38 0
B95(DE3) ΔA ΔfabR ΔserB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_197655 This strain is a derivative of BL21(DE3) with no specific assignment of the UAG codo n/a None PMID:31243963 Derivative of BL21(DE3) with no specific assignment of the UAG codon - 95 endogenous TAG codons mutated to TAA - RF1 (prfA) deleted and fabR spontaneously mutated - serB deleted for phosphoserine genetic code expansion expression applications Primers for verification: - for RF1 (prfA) deletion: AAGCCTTCTATCGTTGCCAAAC, TTATTCCTGCTCGGACAACG - for serB deletion: AGTTTTGTGCGAGCCATCTTCCACC, GTGATGGTGTTCCAGGCATGACAGG This strain is used for expressing phosphoserine-containig proteins using genetic code expansion without buildup of prematurely truncated protein - Recommended plasmids for expressing phosphorylated proteins in this strain are Addgene #173897 (pSer GCE machinery vector) and #174075/174076 (compatible p15a origin of replication plasmids expressing sfGFP proteins from a T7 promoter; sfGFP genes can be removed by restriction digest and replaced with protein-of-interest). Original B95 strain: Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672 Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None Addgene 2026-09-26 02:44:33 2
BL21(DE3) ΔserC
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_197656 This strain is a derivative of BL21(DE3) with the serC gene knocked out n/a None PMID:37122473 Strain is resistant to chloramphenicol. Derivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine. Primers for verification: - for serC deletion: CCTCAACGGTTTTACTCATTGCGATG, CGGGCAGATTAATAGTGCCATCGAC Additional reference: Rogerson et al. Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog. Nat Chem Biol. 2015 Jul;11(7):496-503 Please visit https://www.biorxiv.org/content/10.1101/2021.10.22.465468v2 for bioRxiv preprint. Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None Addgene 2026-09-26 02:44:47 1
E. coli MEV20
 
Resource Report
Resource Website
RRID:Addgene_197113 None E. coli MEV15 is engineered to host diterpenoid biosynthetic pathways. Diterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase(s) and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Diterpenoid production can be induced by IPTG, vanillic acid, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and Streptomyces avermitilis ggps inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing. Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:45:34 0
Z956
 
Resource Report
Resource Website
RRID:Addgene_200838 Genotype: MG1655 rph+, ilvG+, ΔlacZ, ΔrapZ, ΔglmZ, ΔglmY Escherichia coli str. K-12 substr. MG1655 None PMID:36987877 Primer to check deletions: ΔrapZ (5' check primer: GGATACCGAAGGTACTCCGG; 3' check primer: CGTAAGAGCACTTCAGCGTC); ΔglmZ (5' check primer: GTGTAGGATCAAGCTCAGG; 3' check primer: CGGACGCCTACGATTACGC); ΔglmY (5' check primer: GTCTCTTTTTAGCGACACAGTGGC; 3' check primer: GGTGTTACTCTCGTCAGACGCG) Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None rapZ, glmZ and glmY are deleted to avoid interference with plasmid-encoded genes Addgene 2026-09-26 02:45:52 0
E. coli BW25113 ΔtnaA ΔtrpR
 
Resource Report
Resource Website
RRID:Addgene_205015 ΔtnaA ΔtrpR E. coli None PMID:35594503 Primers for PCR verification: veri-trpR-F: AGCAGCTTATAACGCCGGACCAGGG veri-trpR-R: TGGTCCCGTGATGTCGCGTTATAC veri-tnaA-F: CTTGTTTTAGTAAATGATGGTGCTTG veri-tnaA-R: GATCAGTCATGATGCCACCTTTAGAG Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:45:56 0
V. natriegens NC1
 
Resource Report
Resource Website
RRID:Addgene_215355 na None PMID:38352175 Genotype: ATCC14048 + ∆dns + camR + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-9rfOeT70F35Li9CNjCnA?m=slm-n4lGsmu5T0KaunpiH620. Culture in LBv2 or LBv3 broth with 2ug/mL chloramphenicol. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint. Vector Backbone:na; Vector Types:; Bacterial Resistance:None Addgene 2026-09-26 02:47:44 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.