Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 9 showing 161 ~ 180 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_52228

    This resource has 10+ mentions.

http://www.addgene.org/52228

Species: Synthetic
Genetic Insert: GCaMP6s-CAAX
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4005; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24463606
Comments: GCaMP6s (Addgene plasmid 40753) tagged with CAAX motif (amino acids KEKMSKDGKKKKKKSKTKCVIM)

Proper citation: RRID:Addgene_52228 Copy   


  • RRID:Addgene_52225

    This resource has 1+ mentions.

http://www.addgene.org/52225

Species: Schizosaccharomyces pombe
Genetic Insert: rrk1-sgRNA
Vector Backbone Description: Backbone Size:6181; Vector Backbone:pMZ283; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25352017

Proper citation: RRID:Addgene_52225 Copy   


  • RRID:Addgene_52255

    This resource has 1+ mentions.

http://www.addgene.org/52255

Species: Arabidopsis thaliana
Genetic Insert: guide RNA targeting AtPDS3
Vector Backbone Description: Backbone Size:3162; Vector Backbone:pUC119; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23929339
Comments: gRNA target sequence GGACTTTTGCCAGCCATGGT This plasmid is used as a PCR template to assemble new desired guide RNA according to the strategy published in Figure S5 of our Nature Biotechnology paper.

Proper citation: RRID:Addgene_52255 Copy   


  • RRID:Addgene_52258

    This resource has 1+ mentions.

http://www.addgene.org/52258

Species: Homo sapiens
Genetic Insert: SUMO-1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52258 Copy   


  • RRID:Addgene_52179

    This resource has 1+ mentions.

http://www.addgene.org/52179

Species: Homo sapiens
Genetic Insert: F2
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 161

Proper citation: RRID:Addgene_52179 Copy   


  • RRID:Addgene_52177

    This resource has 1+ mentions.

http://www.addgene.org/52177

Species: Homo sapiens
Genetic Insert: APOH
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 158

Proper citation: RRID:Addgene_52177 Copy   


http://www.addgene.org/52211

Species: Homo sapiens
Genetic Insert: p110 alpha E545K
Vector Backbone Description: Backbone Size:12000; Vector Backbone:RCAS (A); Vector Types:Retroviral, avian; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15647370

Proper citation: RRID:Addgene_52211 Copy   


  • RRID:Addgene_52297

    This resource has 1+ mentions.

http://www.addgene.org/52297

Species: Homo sapiens
Genetic Insert: Human GPR56 coding sequence
Vector Backbone Description: Backbone Size:6135; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531968

Proper citation: RRID:Addgene_52297 Copy   


http://www.addgene.org/52216

Species: Homo sapiens
Genetic Insert: HIF1alpha (401delta603) LCLL
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15071503

Proper citation: RRID:Addgene_52216 Copy   


  • RRID:Addgene_52344

    This resource has 10+ mentions.

http://www.addgene.org/52344

Species: Synthetic
Genetic Insert: hrGFP
Vector Backbone Description: Backbone Size:8085; Vector Backbone:AAVS1-CAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24497442
Comments: Please note that this plasmid is NOT the inducible AAVS1-TRE3G-EGFP construct described in the associated publication.

Proper citation: RRID:Addgene_52344 Copy   


  • RRID:Addgene_52342

    This resource has 1+ mentions.

http://www.addgene.org/52342

Species: Synthetic
Genetic Insert: AAVS1 TALEN Right
Vector Backbone Description: Backbone Marker:Keith Joung lab(Addgene Plasmid # 32290) ; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24497442
Comments: Addgene's sequencing results identified a partial duplication within the TALEN repeat region of this plasmid relative to the expected sequence. The depositing lab confirmed that the plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_52342 Copy   


  • RRID:Addgene_52341

    This resource has 1+ mentions.

http://www.addgene.org/52341

Species: Synthetic
Genetic Insert: AAVS1 TALEN Left
Vector Backbone Description: Backbone Marker:Keith Joung lab (Addgene Plasmid # 32290) ; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24497442
Comments: Addgene's sequencing results identified a partial duplication within the TALEN repeat region of this plasmid relative to the expected sequence. The depositing lab confirmed that the plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_52341 Copy   


  • RRID:Addgene_52355

    This resource has 1+ mentions.

http://www.addgene.org/52355

Species: Homo sapiens
Genetic Insert: SDC1
Vector Backbone Description: Backbone Marker:NRC Biotechnology Research Institute; Backbone Size:4401; Vector Backbone:pTT5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23504321

Proper citation: RRID:Addgene_52355 Copy   


  • RRID:Addgene_52356

    This resource has 1+ mentions.

http://www.addgene.org/52356

Species: Mus musculus
Genetic Insert: Mbd3
Vector Backbone Description: Vector Backbone:FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24048479
Comments: Please note that there are several mismatches in between Addgene's quality control and the depositor's sequence. The mismatches do NOT affect plasmid function.

Proper citation: RRID:Addgene_52356 Copy   


  • RRID:Addgene_52401

    This resource has 1+ mentions.

http://www.addgene.org/52401

Species: Homo sapiens
Genetic Insert: Kif2A
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23960144

Proper citation: RRID:Addgene_52401 Copy   


http://www.addgene.org/52409

Species: Other
Genetic Insert: nuclear mCherry
Vector Backbone Description: Vector Backbone:pBRPy-CAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24048479

Proper citation: RRID:Addgene_52409 Copy   


  • RRID:Addgene_52371

    This resource has 1+ mentions.

http://www.addgene.org/52371

Species: Mus musculus
Genetic Insert: Mbd3
Vector Backbone Description: Vector Backbone:Fuw; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24048479
Comments: Please note that there are several mismatches in between Addgene's quality control and the depositor's sequence. The mismatches do NOT affect plasmid function.

Proper citation: RRID:Addgene_52371 Copy   


  • RRID:Addgene_52415

    This resource has 1+ mentions.

http://www.addgene.org/52415

Species: Homo sapiens
Genetic Insert: Proximal element of hOCT4 promoter
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3 promoter; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24172903
Comments: Please note that there are several mismatches in between Addgene's quality control and the depositor's sequence. The mismatches do NOT affect plasmid function.

Proper citation: RRID:Addgene_52415 Copy   


http://www.addgene.org/52380

Species: Synthetic
Genetic Insert: GFP-2A-puro
Vector Backbone Description: Backbone Size:2278; Vector Backbone:minimal Amp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24172903

Proper citation: RRID:Addgene_52380 Copy   


http://www.addgene.org/52421

Species: Synthetic
Genetic Insert: Fusion NLS-EGFP-P2A-Cherry-CAAX
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5508; Vector Backbone:pcDNA3.1-(-)-Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_52421 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X