Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Sp2
Vector Backbone Description: Backbone Marker:Guntram Suske (Addgene plasmid # 24544); Backbone Size:3996; Vector Backbone:pN3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: The plasmid is related to the Addgene plasmids pN3-Sp1FL (#24543), pN3-Sp3FL (#24541) and pN3-Control (#24544)
Proper citation: RRID:Addgene_107718 Copy
Species: Mus musculus
Genetic Insert: Mmu-miR-30a-5p mature sequence
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5699; Vector Backbone:pcDNA6.2-GW/EmGFP; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Spectinomycin
Comments: Mmu-miR-30a-5p mature sequence was cloned following manufacturer’s instructions. It generates an artificial pre-miRNA, which matures to mmu-miR-30a-5p. Plasmid constructed by Marc Beltrà in the Penna lab.
Proper citation: RRID:Addgene_107789 Copy
Species: Mus musculus
Genetic Insert: Estrogen-related receptor gamma
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_107768 Copy
Species: Mus musculus
Genetic Insert: Id1
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:8650; Vector Backbone:pCDH-EF1mcs-PGKpuro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28794185
Proper citation: RRID:Addgene_107735 Copy
Species: Mus musculus
Genetic Insert: mCD44v4
Vector Backbone Description: Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: Addgene NGS results identified R350G and N506S variants compared to the NCBI reference. These are polymorphisms that should not affect plasmid function according to the depositing lab.
Proper citation: RRID:Addgene_107969 Copy
Species: Mus musculus
Genetic Insert: Egr2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5427; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: A Sal I site was introduced before the HindIII site to further transfer to pBabe.
Proper citation: RRID:Addgene_107997 Copy
Species: Mus musculus
Genetic Insert: cGK1 2066bp
Vector Backbone Description: Vector Backbone:pCMV-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_107975 Copy
Species: Mus musculus
Genetic Insert: mCD44v7
Vector Backbone Description: Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: Addgene NGS results identified P22del H23del, S196G, H321Y, and G334S variants compared to the NCBI reference. These are polymorphisms that should not affect plasmid function according to the depositing lab.
Proper citation: RRID:Addgene_107971 Copy
Species: Mus musculus
Genetic Insert: Egr4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5427; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: A Sal I site was introduced before the HindIII site to further transfer to pBabe.
Proper citation: RRID:Addgene_108096 Copy
Species: Mus musculus
Genetic Insert: Egr4
Vector Backbone Description: Backbone Size:5086; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: The Egr4 gene was transferred from pcDNA3.1-Egr4 (Addgene plasmid 108096) to the pBabe(puro) retroviral vector using EcoRI and SalI sites.
Proper citation: RRID:Addgene_108105 Copy
Species: Mus musculus
Genetic Insert: Egr3
Vector Backbone Description: Backbone Size:5086; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: The Egr3 gene was transferred from pcDNA3.1-Egr3 (Addgene plasmid 107998) to the pBabe(puro) retroviral vector using EcoRI and SalI sites.
Proper citation: RRID:Addgene_108102 Copy
Species: Mus musculus
Genetic Insert: Vmn2r120
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3015; Vector Backbone:pGEM-T Easy; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786
Proper citation: RRID:Addgene_108087 Copy
Species: Mus musculus
Genetic Insert: Vmn2r118
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3015; Vector Backbone:pGEM-T Easy; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786
Proper citation: RRID:Addgene_108086 Copy
Species: Mus musculus
Genetic Insert: shRNA to Egr4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6445; Vector Backbone:pSirenRetroQ(puro); Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: For the chosen sequence (AAGTCTTTGGATGTGATGTTT), the annealed oligos are:
5'-gatccAAGTCTTTGGATGTGATGTTTTTCAAGAGAAAACATCACATCCAAAGACTTTTTTTTACGCGTg-----3'
3'-----gTTCAGAAACCTACACTACAAAAAGTTCTCTTTTGTAGTGTAGGTTTCTGAAAAAAAATGCGCActtaa-5'
Proper citation: RRID:Addgene_108117 Copy
Species: Mus musculus
Genetic Insert: shRNA to Egr3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6445; Vector Backbone:pSirenRetroQ(puro); Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: For the chosen sequence (AATCAATTGCCTGACAATC), the annealed oligos were:
5'-gatccAATCAATTGCCTGACAATCTTCAAGAGAGATTGTCAGGCAATTGATTTTTTTTACGCGTg-----3'
3'-gTTAGTTAACGGACTGTTAGAAGTTCTCTCTAACAGTCCGTTAACTAAAAAAAATGCGCActtaa-5'
Proper citation: RRID:Addgene_108115 Copy
Species: Mus musculus
Genetic Insert: Vmn2r1-Hprt (5')-loxP-neo
Vector Backbone Description: Backbone Marker:Agilent Technologies/Stratagene; Backbone Size:2900; Vector Backbone:pBluescript II SK+; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786
Proper citation: RRID:Addgene_108079 Copy
Species: Mus musculus
Genetic Insert: PKD1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897
Proper citation: RRID:Addgene_108403 Copy
Species: Mus musculus
Genetic Insert: PKD1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897
Proper citation: RRID:Addgene_108402 Copy
Species: Mus musculus
Genetic Insert: Pkd1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897
Proper citation: RRID:Addgene_108395 Copy
Species: Mus musculus
Genetic Insert: Pkd1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:modified pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29426897
Proper citation: RRID:Addgene_108392 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.