Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
MSP11-bio Resource Report Resource Website |
RRID:Addgene_47734 | Codon-optimised MSP11 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine41, Serine87, Threonine93 and Serine128 to Alanine residues | 2026-08-15 01:15:43 | 0 | |
|
Pf113-bio Resource Report Resource Website 1+ mentions |
RRID:Addgene_47729 | Codon-optimised Pf113 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine209, Serine270, Threonine319, Serine362, Serine663, Threonine699, Serine781, Threonine878 and Threonine940 to Alanine residues | 2026-08-15 01:15:44 | 2 | |
|
pFAB3869 Resource Report Resource Website |
RRID:Addgene_47842 | promoter 11 and BCD1 | Synthetic | Kanamycin | PMID:23474465 | http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 122.59 | Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:44 | 0 | |
|
pFAB3845 Resource Report Resource Website |
RRID:Addgene_47840 | promoter 9 and BCD1 | Synthetic | Kanamycin | PMID:23474465 | http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 69.62 | Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:44 | 0 | |
|
pFAB3737 Resource Report Resource Website |
RRID:Addgene_47838 | promoter 7 and BCD1 | Synthetic | Kanamycin | PMID:23474465 | http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 404.1 | Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:46 | 0 | |
|
CLAG3.2-bio Resource Report Resource Website |
RRID:Addgene_47797 | Codon-optimised CLAG3.2 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Threonine75, Threonine114, Threonine476, Threonine542, Threonine641, Serine941, Serine1013, Serine1062, Threonine1130 and Threonine1373 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
pFAB3999 Resource Report Resource Website |
RRID:Addgene_47830 | promoter 14 and BCD23 | Synthetic | Kanamycin | PMID:23474465 | http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 52.63 | Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:44 | 0 | |
|
pFAB3701 Resource Report Resource Website |
RRID:Addgene_47835 | promoter 4 and BCD1 | Synthetic | Kanamycin | PMID:23474465 | http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 50.75 | Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:46 | 0 | |
|
PTRAMP-bio Resource Report Resource Website |
RRID:Addgene_47793 | Codon-optimised PTRAMP | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine114, Serine151, Serine157, Serine172, Threonine197, Threonine204 and Serine255 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
RAP1-bio Resource Report Resource Website |
RRID:Addgene_47794 | Codon-optimised RAP1 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine74, Threonine84, Serine92, Serine170, Threonine329, Serine357 and Threonine404 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
PF3D7_1431400-bio Resource Report Resource Website |
RRID:Addgene_47791 | Codon-optimised PF3D7_1431400 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine27, Serine31, Serine35, Threonine70, Serine102, Serine103, Serine300, Threonine309, Threonine313, Threonine387, Serine481, Serine497, Serine498, Serine502, Serine513, Serine551, Serine574, Threonine622, Threonine644, Serine732, Serine743, Serine785 and Serine962 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
EBL1-bio Resource Report Resource Website |
RRID:Addgene_47792 | Codon-optimised EBL1 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine37, Serine53, Serine150, Serine255, Threonine313, Serine722, Serine845, Serine957, Serine1010, Serine1175, Serine1220, Serine1239, Serine1325, Threonine1346, Serine1352, Serine1606, Threonine1798, Serine1829, Serine2161, Serine2310, Serine2356, Serine2403, Threonine2426, Threonine2432, Serine2480, Serine2508, Threonine2518, Serine2560 and Threonine2573 to Alanine residues | 2026-08-15 01:15:45 | 0 | |
|
pMB66 Resource Report Resource Website |
RRID:Addgene_47946 | Cas9 | Synthetic | Ampicillin | PMID:23979586 | To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:46 | 0 | |
|
pMB62 Resource Report Resource Website |
RRID:Addgene_47944 | Cas9 | Synthetic | Ampicillin | PMID:23979586 | To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:47 | 0 | |
|
pMB63 Resource Report Resource Website |
RRID:Addgene_47945 | Cas9 | Synthetic | Ampicillin | PMID:23979586 | To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:46 | 0 | |
|
pMB70 Resource Report Resource Website |
RRID:Addgene_47943 | guide RNA | Synthetic | Kanamycin | PMID:23979586 | Backbone Marker:Geneart; Vector Backbone:pMK; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:46 | 0 | ||
|
pIK86 Resource Report Resource Website |
RRID:Addgene_47933 | Cas9 | Synthetic | Ampicillin | PMID:23979578 | Backbone Size:2730; Vector Backbone:pUC57; Vector Types:CRISPR, Unspecified; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:45 | 0 | ||
|
pcDNA-T1ER Resource Report Resource Website 1+ mentions |
RRID:Addgene_47928 | T1ER | Synthetic | Ampicillin | PMID:23838183 | Ratiometric calcium sensor targeted to ER with KDEL sequence. The CFP fragment of Addgene plasmid 36325 pcDNA-D1ER was replaced with the brighter fluorescent protein mTurquoise. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | KDEL | 2026-08-15 01:15:47 | 2 |
|
pCS2-nCas9n Resource Report Resource Website 100+ mentions |
RRID:Addgene_47929 | nls-zcas9-nls | Synthetic | Ampicillin | PMID:23918387 | Note from depositor: Although this plasmid produces smaller transcripts in addition to the expected one, the product mixture displays activity comparable to that from pT3TS-nCas9n. For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ | Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:45 | 103 | |
|
pFAB1935 Resource Report Resource Website |
RRID:Addgene_47860 | his_T_min_linker_crp_T_min double terminator | Synthetic | Kanamycin | PMID:23474465 | Terminator efficiency measured at 99% (97% and 73% alone, respectively). Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. | Backbone Size:3967; Vector Backbone:pFAB777; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | concatenate of his_min and crp_min | 2026-08-15 01:15:46 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
