Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Streptomyces pristinaespiralis
Genetic Insert: P-furA102tetO-pip
Vector Backbone Description: Backbone Marker:Graham Hatfull (Addgene plasmid # 91723); Backbone Size:5852; Vector Backbone:pTTP1.B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:30962489
Comments: The sequence is that of pTTP1B with P-furA 102 tetO- pip cloned into the EcoRI site.
Proper citation: RRID:Addgene_131105 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:32169219
Comments: Please note that there are minor differences between the Addgene verified result and the depositor's reference sequence (under the supplemental documents section). Please refer to the Addgene NGS result for more accurate sequence information. These differences do not affect the plasmid function.
Proper citation: RRID:Addgene_139098 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:32169219
Proper citation: RRID:Addgene_139099 Copy
Species: Pseudomonas putida
Genetic Insert: upp
Vector Backbone Description: Vector Backbone:pJOE6186.1 ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:21666018
Proper citation: RRID:Addgene_135079 Copy
Species: Synthetic
Genetic Insert: CRISPR/Cas9
Vector Backbone Description: Vector Backbone:pGreen3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31558579
Proper citation: RRID:Addgene_134748 Copy
Species: Synthetic
Genetic Insert: CRISPR/Cas9
Vector Backbone Description: Vector Backbone:pGreen3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31558579
Proper citation: RRID:Addgene_134749 Copy
Species: Synthetic
Genetic Insert: CRISPR/Cas9
Vector Backbone Description: Vector Backbone:pGreen3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31558579
Proper citation: RRID:Addgene_134750 Copy
Species: Synthetic
Genetic Insert: CRISPR/Cas9
Vector Backbone Description: Vector Backbone:pGreen3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31558579
Proper citation: RRID:Addgene_134753 Copy
Species: Synthetic
Genetic Insert: CRISPR/Cas9
Vector Backbone Description: Vector Backbone:pGreen3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31558579
Proper citation: RRID:Addgene_134755 Copy
Species: Synthetic
Genetic Insert: CRISPR/Cas9
Vector Backbone Description: Vector Backbone:pGreen3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31558579
Proper citation: RRID:Addgene_134756 Copy
Species: Synthetic
Genetic Insert: CRISPR/Cas9
Vector Backbone Description: Vector Backbone:pGreen3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31558579
Proper citation: RRID:Addgene_134758 Copy
Species: Synthetic
Genetic Insert: CRISPR/Cas9
Vector Backbone Description: Vector Backbone:pCambia; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31558579
Proper citation: RRID:Addgene_134760 Copy
Species: Homo sapiens
Genetic Insert: 3xFlag-PUFa-TET1(CD)
Vector Backbone Description: Backbone Size:11698; Vector Backbone:pAT1501; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31541098
Proper citation: RRID:Addgene_134977 Copy
Species: Other
Genetic Insert: HA-dCas9
Vector Backbone Description: Backbone Size:11095; Vector Backbone:pAT1502; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31541098
Proper citation: RRID:Addgene_134895 Copy
Genetic Insert: Kanamycin selection marker flanked by ~200 bp of homology to bacteriophage lambda
Vector Backbone Description: Backbone Size:2957; Vector Backbone:pUC19; Vector Types:λ-phage recombineering plasmid; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28522818
Comments: Please note that there are several discrepancies between Addgene's quality control and the depositor's sequence that affects restriction enzyme sites.
Proper citation: RRID:Addgene_133935 Copy
Species: Other
Genetic Insert: CAG-LSL-dCas9-10xGCN4-P2A-scFv-P65-HSF1-T2A-EGFP-WPRE-PolyA
Vector Backbone Description: Vector Backbone:PB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29335603
Proper citation: RRID:Addgene_107307 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-30c-2-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103414 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-30c-1-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103413 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-3158-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103428 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-3130-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103423 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
