Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Authority:addgene (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

177,820 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCRII-Topo Plexin D1 in situ probe
 
Resource Report
Resource Website
RRID:Addgene_45621 Plexin D1 in situ probe Mus musculus Ampicillin PMID:16157277 The Plexin D1 fragment was amplified by RT-PCR using the following primer pair: CAGGAAATGAACGCACACC TGAGGGACACAGACAACTGC; For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin fragment contains bp# 5751-6406 of NM_026376.3 2026-08-15 01:15:25 0
pET28b-Ava3856
 
Resource Report
Resource Website
RRID:Addgene_45742 Ava3856 Anabaena variabilis Kanamycin PMID:20813918 Backbone Marker:Novagen; Backbone Size:5293; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:26 0
pET29b-Ava3858-3856
 
Resource Report
Resource Website
RRID:Addgene_45745 Ava3858-3856 Anabaena variabilis Kanamycin PMID:20813918 Backbone Marker:Novagen; Backbone Size:5238; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:26 0
pCRII-Topo Cux2 in situ probe
 
Resource Report
Resource Website
RRID:Addgene_45623 Cux2 in situ probe Mus musculus Ampicillin PMID:16157277 The Cux2 fragment was amplified by RT-PCR using the following primer pair: TCAGTCAACAGCTCCATTCG GACAGCGAGAAAGTCCTTGG For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin fragment contains nt 1069-1694 on NM_007804 2026-08-15 01:15:25 0
pSABAD505
 
Resource Report
Resource Website
RRID:Addgene_45615 GFPN-NpuDnaE_intein-GFP_C Nostoc punctiforme Ampicillin PMID:23974115 Backbone Marker:invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin stemmer GFP with superfolder mutations S30R and Y39N, and SYG->CYG in chromophore 2026-08-15 01:15:25 0
pJORSF19
 
Resource Report
Resource Website
RRID:Addgene_45614 PhoRadA precursor pyrococcus horikoshii Kanamycin PMID:23974115 Backbone Marker:MerckMillipore; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:25 0
pSABAD14-750
 
Resource Report
Resource Website
RRID:Addgene_45616 MjaTFIIBC53 (Methanocaldococcus jannaschii DSM 2661) Ampicillin PMID:23974115 There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function. Backbone Marker:Invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 0
pSARSF534-3
 
Resource Report
Resource Website
RRID:Addgene_45618 NpuDnaEC35-GFP_C Nostoc punctiforme Kanamycin PMID:23974115 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin SYG->CYG in chromophore 2026-08-15 01:15:25 0
pCVL.SFFV.Kozak.HA.NLS.SceOpt.IRES.BFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45574 co I-Sce I Ampicillin PMID:24121685 Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin co indicates codon optimization for mammalian expression 2026-08-15 01:15:25 4
pCVL.Active/Repressed TLR (Sce)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45575 eGFP with I-Sce I TS Homo sapiens Ampicillin PMID:24121685 Backbone Size:4483; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Bacterial Expression, Lentiviral; Bacterial Resistance:Ampicillin embedded I-Sce I TS from 163-185 2026-08-15 01:15:25 1
pCVL.SFFV.Kozak.HA.NLS.Y2Ani.IRES.BFP
 
Resource Report
Resource Website
RRID:Addgene_45578 coY2 Ani Ampicillin PMID:24121685 Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin co indicates codon optimization for mammalian expression. 2026-08-15 01:15:25 0
pBp-FGFR2c-WT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45699 FGFR2 IIIc Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 6
pSABAD332
 
Resource Report
Resource Website
RRID:Addgene_45610 PhoRadAC46 Pyrococcus horikoshii Ampicillin PMID:23974115 There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function. Backbone Marker:invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 0
pBp-FGFR2b-WT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45698 FGFR2 IIIb Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 6
pCVL.SFFV.Kozak.HA.NLS.Y2AniK227M.IRES.BFP
 
Resource Report
Resource Website
RRID:Addgene_45579 coY2 Ani K227M Ampicillin PMID:24121685 Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin co indicates codon optimization for mammalian expression. K227M mutation confers nickase activity 2026-08-15 01:15:25 0
pSABAD250
 
Resource Report
Resource Website
RRID:Addgene_45612 NpuDnaBC39 nostoc punctiforme Ampicillin PMID:23974115 There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function. Backbone Marker:Invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 0
pGEX-5X-TRIM28
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45570 TRIM28 Homo sapiens Ampicillin PMID:21940674 Full-length human TRIM28 was purchased from Origene and subcloned into vector pKH3 to generate pKH3-Trim28 (Addgene plasmid #45569). A full length TRIM28 DNA fragment was then generated from pKH3-TRIM28 by PCR and cloned into pGEX-5X. Backbone Marker:Amersham GE Healthcare; Backbone Size:5000; Vector Backbone:pGEX-5X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 2
pKD3
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45604 FRT-cat-FRT Chloramphenicol and Ampicillin PMID:10829079 This is a template plasmids for frt-flanked cat cassette. The cat cassette originally came from pSC140. pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression. Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:25 20
FDA60
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45606 FDA60 Synthetic Ampicillin Backbone Size:5358; Vector Backbone:peT21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 1
pKD4
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45605 FRT-kan-FRT Ampicillin and Kanamycin PMID:10829079 This is a template plasmids for frt-flanked kan cassette. The kan cassette originally came from pCP15. pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression. Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:15:25 28

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.