Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Plexin D1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16157277
Comments: The Plexin D1 fragment was amplified by RT-PCR using the following primer pair:
CAGGAAATGAACGCACACC
TGAGGGACACAGACAACTGC;
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45621 Copy
Species: Anabaena variabilis
Genetic Insert: Ava3856
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5293; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20813918
Proper citation: RRID:Addgene_45742 Copy
Species: Anabaena variabilis
Genetic Insert: Ava3858-3856
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5238; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20813918
Proper citation: RRID:Addgene_45745 Copy
Species: Mus musculus
Genetic Insert: Cux2 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16157277
Comments: The Cux2 fragment was amplified by RT-PCR using the following primer pair:
TCAGTCAACAGCTCCATTCG
GACAGCGAGAAAGTCCTTGG
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.
Proper citation: RRID:Addgene_45623 Copy
Species: Nostoc punctiforme
Genetic Insert: GFPN-NpuDnaE_intein-GFP_C
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23974115
Proper citation: RRID:Addgene_45615 Copy
Species: pyrococcus horikoshii
Genetic Insert: PhoRadA precursor
Vector Backbone Description: Backbone Marker:MerckMillipore; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23974115
Proper citation: RRID:Addgene_45614 Copy
Species: (Methanocaldococcus jannaschii DSM 2661)
Genetic Insert: MjaTFIIBC53
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23974115
Comments: There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function.
Proper citation: RRID:Addgene_45616 Copy
Species: Nostoc punctiforme
Genetic Insert: NpuDnaEC35-GFP_C
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23974115
Proper citation: RRID:Addgene_45618 Copy
Genetic Insert: co I-Sce I
Vector Backbone Description: Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121685
Proper citation: RRID:Addgene_45574 Copy
Species: Homo sapiens
Genetic Insert: eGFP with I-Sce I TS
Vector Backbone Description: Backbone Size:4483; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Bacterial Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121685
Proper citation: RRID:Addgene_45575 Copy
Genetic Insert: coY2 Ani
Vector Backbone Description: Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121685
Proper citation: RRID:Addgene_45578 Copy
Species: Homo sapiens
Genetic Insert: FGFR2 IIIc
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770
Proper citation: RRID:Addgene_45699 Copy
Species: Pyrococcus horikoshii
Genetic Insert: PhoRadAC46
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23974115
Comments: There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function.
Proper citation: RRID:Addgene_45610 Copy
Species: Homo sapiens
Genetic Insert: FGFR2 IIIb
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770
Proper citation: RRID:Addgene_45698 Copy
Genetic Insert: coY2 Ani K227M
Vector Backbone Description: Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121685
Proper citation: RRID:Addgene_45579 Copy
Species: nostoc punctiforme
Genetic Insert: NpuDnaBC39
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23974115
Comments: There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function.
Proper citation: RRID:Addgene_45612 Copy
Species: Homo sapiens
Genetic Insert: TRIM28
Vector Backbone Description: Backbone Marker:Amersham GE Healthcare; Backbone Size:5000; Vector Backbone:pGEX-5X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21940674
Comments: Full-length human TRIM28 was purchased from Origene and subcloned into vector pKH3 to generate pKH3-Trim28 (Addgene plasmid #45569). A full length TRIM28 DNA fragment was then generated from pKH3-TRIM28 by PCR and cloned into pGEX-5X.
Proper citation: RRID:Addgene_45570 Copy
Genetic Insert: FRT-cat-FRT
Vector Backbone Description: Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:10829079
Comments: This is a template plasmids for frt-flanked cat cassette. The cat cassette originally came from pSC140.
pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression.
Proper citation: RRID:Addgene_45604 Copy
Species: Synthetic
Genetic Insert: FDA60
Vector Backbone Description: Backbone Size:5358; Vector Backbone:peT21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45606 Copy
Genetic Insert: FRT-kan-FRT
Vector Backbone Description: Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:10829079
Comments: This is a template plasmids for frt-flanked kan cassette. The kan cassette originally came from pCP15.
pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression.
Proper citation: RRID:Addgene_45605 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.