Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCRII-Topo Plexin D1 in situ probe Resource Report Resource Website |
RRID:Addgene_45621 | Plexin D1 in situ probe | Mus musculus | Ampicillin | PMID:16157277 | The Plexin D1 fragment was amplified by RT-PCR using the following primer pair: CAGGAAATGAACGCACACC TGAGGGACACAGACAACTGC; For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 5751-6406 of NM_026376.3 | 2026-08-15 01:15:25 | 0 |
|
pET28b-Ava3856 Resource Report Resource Website |
RRID:Addgene_45742 | Ava3856 | Anabaena variabilis | Kanamycin | PMID:20813918 | Backbone Marker:Novagen; Backbone Size:5293; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:26 | 0 | ||
|
pET29b-Ava3858-3856 Resource Report Resource Website |
RRID:Addgene_45745 | Ava3858-3856 | Anabaena variabilis | Kanamycin | PMID:20813918 | Backbone Marker:Novagen; Backbone Size:5238; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:26 | 0 | ||
|
pCRII-Topo Cux2 in situ probe Resource Report Resource Website |
RRID:Addgene_45623 | Cux2 in situ probe | Mus musculus | Ampicillin | PMID:16157277 | The Cux2 fragment was amplified by RT-PCR using the following primer pair: TCAGTCAACAGCTCCATTCG GACAGCGAGAAAGTCCTTGG For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains nt 1069-1694 on NM_007804 | 2026-08-15 01:15:25 | 0 |
|
pSABAD505 Resource Report Resource Website |
RRID:Addgene_45615 | GFPN-NpuDnaE_intein-GFP_C | Nostoc punctiforme | Ampicillin | PMID:23974115 | Backbone Marker:invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | stemmer GFP with superfolder mutations S30R and Y39N, and SYG->CYG in chromophore | 2026-08-15 01:15:25 | 0 | |
|
pJORSF19 Resource Report Resource Website |
RRID:Addgene_45614 | PhoRadA precursor | pyrococcus horikoshii | Kanamycin | PMID:23974115 | Backbone Marker:MerckMillipore; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:25 | 0 | ||
|
pSABAD14-750 Resource Report Resource Website |
RRID:Addgene_45616 | MjaTFIIBC53 | (Methanocaldococcus jannaschii DSM 2661) | Ampicillin | PMID:23974115 | There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function. | Backbone Marker:Invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 0 | |
|
pSARSF534-3 Resource Report Resource Website |
RRID:Addgene_45618 | NpuDnaEC35-GFP_C | Nostoc punctiforme | Kanamycin | PMID:23974115 | Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | SYG->CYG in chromophore | 2026-08-15 01:15:25 | 0 | |
|
pCVL.SFFV.Kozak.HA.NLS.SceOpt.IRES.BFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_45574 | co I-Sce I | Ampicillin | PMID:24121685 | Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | co indicates codon optimization for mammalian expression | 2026-08-15 01:15:25 | 4 | ||
|
pCVL.Active/Repressed TLR (Sce) Resource Report Resource Website 1+ mentions |
RRID:Addgene_45575 | eGFP with I-Sce I TS | Homo sapiens | Ampicillin | PMID:24121685 | Backbone Size:4483; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Bacterial Expression, Lentiviral; Bacterial Resistance:Ampicillin | embedded I-Sce I TS from 163-185 | 2026-08-15 01:15:25 | 1 | |
|
pCVL.SFFV.Kozak.HA.NLS.Y2Ani.IRES.BFP Resource Report Resource Website |
RRID:Addgene_45578 | coY2 Ani | Ampicillin | PMID:24121685 | Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | co indicates codon optimization for mammalian expression. | 2026-08-15 01:15:25 | 0 | ||
|
pBp-FGFR2c-WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_45699 | FGFR2 IIIc | Homo sapiens | Ampicillin | PMID:23786770 | Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 6 | ||
|
pSABAD332 Resource Report Resource Website |
RRID:Addgene_45610 | PhoRadAC46 | Pyrococcus horikoshii | Ampicillin | PMID:23974115 | There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function. | Backbone Marker:invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 0 | |
|
pBp-FGFR2b-WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_45698 | FGFR2 IIIb | Homo sapiens | Ampicillin | PMID:23786770 | Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 6 | ||
|
pCVL.SFFV.Kozak.HA.NLS.Y2AniK227M.IRES.BFP Resource Report Resource Website |
RRID:Addgene_45579 | coY2 Ani K227M | Ampicillin | PMID:24121685 | Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | co indicates codon optimization for mammalian expression. K227M mutation confers nickase activity | 2026-08-15 01:15:25 | 0 | ||
|
pSABAD250 Resource Report Resource Website |
RRID:Addgene_45612 | NpuDnaBC39 | nostoc punctiforme | Ampicillin | PMID:23974115 | There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function. | Backbone Marker:Invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 0 | |
|
pGEX-5X-TRIM28 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45570 | TRIM28 | Homo sapiens | Ampicillin | PMID:21940674 | Full-length human TRIM28 was purchased from Origene and subcloned into vector pKH3 to generate pKH3-Trim28 (Addgene plasmid #45569). A full length TRIM28 DNA fragment was then generated from pKH3-TRIM28 by PCR and cloned into pGEX-5X. | Backbone Marker:Amersham GE Healthcare; Backbone Size:5000; Vector Backbone:pGEX-5X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 2 | |
|
pKD3 Resource Report Resource Website 10+ mentions |
RRID:Addgene_45604 | FRT-cat-FRT | Chloramphenicol and Ampicillin | PMID:10829079 | This is a template plasmids for frt-flanked cat cassette. The cat cassette originally came from pSC140. pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression. | Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:25 | 20 | ||
|
FDA60 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45606 | FDA60 | Synthetic | Ampicillin | Backbone Size:5358; Vector Backbone:peT21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 1 | |||
|
pKD4 Resource Report Resource Website 10+ mentions |
RRID:Addgene_45605 | FRT-kan-FRT | Ampicillin and Kanamycin | PMID:10829079 | This is a template plasmids for frt-flanked kan cassette. The kan cassette originally came from pCP15. pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression. | Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:15:25 | 28 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
