Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 91 showing 1801 ~ 1820 out of 177,820 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/45565

Species: Homo sapiens
Genetic Insert: I-Sce I Nuclease
Vector Backbone Description: Backbone Size:3724; Vector Backbone:pExodus; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121685

Proper citation: RRID:Addgene_45565 Copy   


  • RRID:Addgene_45567

    This resource has 10+ mentions.

http://www.addgene.org/45567

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5729; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid pIRES-EGFP-puro was constructed containing the Phcmv promoter followed by unique restriction sites (NheI, XhoI, and SacI) for insertion of genes. Downstream, an IRES from the encephalomyocarditis virus directs the translation of EGFP-puro from the same mRNA. Addgene's sequencing results found differences compared to the depositing lab's sequence in the 3' region of the puro resistance marker. The resulting protein sequence matches NCBI WP_055528321.1 and should be functional.

Proper citation: RRID:Addgene_45567 Copy   


http://www.addgene.org/45600

Species: Mus musculus
Genetic Insert: Crim1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15664173
Comments: Fragment was amplified using the following primers: TCTCAAGACTGTTGGTTGCTG TGAACAACCAATGATAGCACAG For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp#4062-4502 of NM_015800.3, not bp# 4708-5148 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45600 Copy   


  • RRID:Addgene_45569

    This resource has 10+ mentions.

http://www.addgene.org/45569

Species: Homo sapiens
Genetic Insert: TRIM28
Vector Backbone Description: Backbone Marker:Addgene plasmid Plasmid 12555; Backbone Size:4800; Vector Backbone:pKH3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21940674
Comments: Full-length human TRIM28 was purchased from Origene and subcloned into vector pKH3 to generate pKH3-Trim28.

Proper citation: RRID:Addgene_45569 Copy   


http://www.addgene.org/45602

Species: Mus musculus
Genetic Insert: Diap3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15664173
Comments: Fragment was amplified using the following primers: AGCAGTTCGCTGTTGTGATG GCACGTTTCTCCTTTTCTGC For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1589-2321 of BC028920, not bp# 1610-2321 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45602 Copy   


  • RRID:Addgene_45561

    This resource has 10+ mentions.

http://www.addgene.org/45561

Genetic Insert: Puromycin N-acetyl transferase
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression, Bifunctional selection protein; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11515370
Comments: Plasmid pEGFP-puro was constructed by PCR amplification of PuroR coding sequences from pPur (Clontech Laboratories, Palo Alto CA, USA) using upstream (5'-AAGTCCGGACTCAGATCTAGGAGACGACCTTCCATGACCGAGT-3') and downstream (5'-GTTATCTAGATCCGGTGGATCCCGGGCACCGGGCTTGCGGGTCATGCACCA-3') primers, digestion of the PCR product with BglII andBamHI, and ligation into BglII/BamHI digested pEGFP-C1 (Clontech Laboratories). To construct a fusion protein containing both EGFP and PuroR sequences, PuroR coding sequences were ligated into an existing expression cassette for EGFP. The resulting fusion protein was designated EGFP-puro and is contained in plasmid pEGFP-puro. This plasmid contains the strong human cytomegalovirus immediate early promoter (Phcmv), the EGFP puro open reading frame, and the simian virus 40 (SV40) polyadenylation signal. The EGFP-puro protein contains the first 245 amino acids of EGFP. The C-terminal five amino acids of EGFP were deleted and replaced by four linker-encoded amino acids, followed by the complete 200-amino-acid PuroR sequence. The C-terminus is formed by 11 amino acids encoded by vector sequences. The resulting fusion protein (EGFP-puro) confers both green fluorescence and resistance to puromycin when expressed in mammalian cells.

Proper citation: RRID:Addgene_45561 Copy   


  • RRID:Addgene_45710

http://www.addgene.org/45710

Species: Homo sapiens
Genetic Insert: FGFR2 IIIc
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45710 Copy   


  • RRID:Addgene_45703

http://www.addgene.org/45703

Species: Homo sapiens
Genetic Insert: FGFR2 IIIb
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45703 Copy   


  • RRID:Addgene_45705

http://www.addgene.org/45705

Species: Homo sapiens
Genetic Insert: FGFR2 IIIb
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45705 Copy   


  • RRID:Addgene_45704

http://www.addgene.org/45704

Species: Homo sapiens
Genetic Insert: FGFR2 IIIc
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45704 Copy   


  • RRID:Addgene_45707

http://www.addgene.org/45707

Species: Homo sapiens
Genetic Insert: FGFR2 IIIb
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45707 Copy   


  • RRID:Addgene_45706

http://www.addgene.org/45706

Species: Homo sapiens
Genetic Insert: FGFR2 IIIc
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45706 Copy   


  • RRID:Addgene_45708

http://www.addgene.org/45708

Species: Homo sapiens
Genetic Insert: FGFR2 IIIc
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45708 Copy   


  • RRID:Addgene_45701

http://www.addgene.org/45701

Species: Homo sapiens
Genetic Insert: FGFR2 IIIc
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45701 Copy   


  • RRID:Addgene_45769

    This resource has 10+ mentions.

http://www.addgene.org/45769

Species: Homo sapiens
Genetic Insert: hE-cadherin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11381089
Comments: Partial cDNA for human E-cadherin was provided by D. Rimm (Yale University, New Haven, CT) and subcloned into the pcDNA3 mammalian expression vector (Invitrogen), to generate Addgene plasmid 45772. Sequence analysis revealed that the 3′ end of the gene was missing after nucleotide 2644 (according to EMBL/GenBank/DDBJ under accession number L08599). This resulted in a truncation of the last 35 amino acids of the E-cadherin cytoplasmic domain and, as a result, did not contain the β-catenin binding region, as defined by Stappert and Kemler 1994. The COOH terminus of this truncation mutant (E-cadherin Δ β-catenin) ends at amino acid 844 (NH3-ASLSSD); the frameshift added a single histidine residue before a stop codon is introduced. The full-length human E-cadherin was reengineered using RNA from human A431 cells and the RT-PCR method (Primer A, 5′-TGACACCCGGGACAACGTTTATTA-3′, and Primer C, 5′-CTAGTCTAGACCCCTAGTGGTCCTCG-3′) to generate a 425-bp fragment encoding the missing COOH-terminal residues. This fragment was sub-cloned into the truncated hEcad-Δ 35/pcDNA3 vector (Addgene plasmid 45772) to generate full-length hEcad/pcDNA3 (Addgene plasmid 45769).

Proper citation: RRID:Addgene_45769 Copy   


  • RRID:Addgene_45801

    This resource has 1+ mentions.

http://www.addgene.org/45801

Vector Backbone Description: Backbone Size:3019; Vector Backbone:pBSTNAV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23804766

Proper citation: RRID:Addgene_45801 Copy   


  • RRID:Addgene_45808

http://www.addgene.org/45808

Species: Rattus norvegicus
Genetic Insert: α1Ic
Vector Backbone Description: Backbone Marker:Perez-Reyes; Backbone Size:5400; Vector Backbone:pcDNA3-HE2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12297319

Proper citation: RRID:Addgene_45808 Copy   


  • RRID:Addgene_45760

    This resource has 1+ mentions.

http://www.addgene.org/45760

Species: Rattus norvegicus
Genetic Insert: alpha 1A AR
Vector Backbone Description: Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1970822

Proper citation: RRID:Addgene_45760 Copy   


  • RRID:Addgene_45763

    This resource has 1+ mentions.

http://www.addgene.org/45763

Species: Homo sapiens
Genetic Insert: lincRNA-RoR cDNA
Vector Backbone Description: Backbone Marker:Bob Weinberg; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21057500
Comments: Note that though there are some small discrepancies between Addgene's quality control sequence and the depositor's assembled sequence, they do not affect function.

Proper citation: RRID:Addgene_45763 Copy   


http://www.addgene.org/45764

Species: Homo sapiens
Genetic Insert: lincRNA-RoR-shRNA1
Vector Backbone Description: Backbone Marker:Bob Weinberg; Backbone Size:7032; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21057500

Proper citation: RRID:Addgene_45764 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X