Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Authority:addgene (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

177,820 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pEX.sEF1a.Kozak.HA.NLS.Sce.T2A.BFP
 
Resource Report
Resource Website
RRID:Addgene_45565 I-Sce I Nuclease Homo sapiens Ampicillin PMID:24121685 Backbone Size:3724; Vector Backbone:pExodus; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 0
pIRES-EGFP-puro
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45567 Ampicillin Plasmid pIRES-EGFP-puro was constructed containing the Phcmv promoter followed by unique restriction sites (NheI, XhoI, and SacI) for insertion of genes. Downstream, an IRES from the encephalomyocarditis virus directs the translation of EGFP-puro from the same mRNA. Addgene's sequencing results found differences compared to the depositing lab's sequence in the 3' region of the puro resistance marker. The resulting protein sequence matches NCBI WP_055528321.1 and should be functional. Backbone Marker:Clontech; Backbone Size:5729; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 24
pCRII-Topo Crim1 in situ probe
 
Resource Report
Resource Website
RRID:Addgene_45600 Crim1 in situ probe Mus musculus Ampicillin PMID:15664173 Fragment was amplified using the following primers: TCTCAAGACTGTTGGTTGCTG TGAACAACCAATGATAGCACAG For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp#4062-4502 of NM_015800.3, not bp# 4708-5148 as indicated on plasmid map. The plasmid functions as described in the associated publication. Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin insert contains bp#4062-4502 of NM_015800.3 2026-08-15 01:15:25 0
pKH3-TRIM28
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45569 TRIM28 Homo sapiens Ampicillin PMID:21940674 Full-length human TRIM28 was purchased from Origene and subcloned into vector pKH3 to generate pKH3-Trim28. Backbone Marker:Addgene plasmid Plasmid 12555; Backbone Size:4800; Vector Backbone:pKH3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 11
pCRII-Topo Diap3 in situ probe
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45602 Diap3 in situ probe Mus musculus Ampicillin PMID:15664173 Fragment was amplified using the following primers: AGCAGTTCGCTGTTGTGATG GCACGTTTCTCCTTTTCTGC For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1589-2321 of BC028920, not bp# 1610-2321 as indicated on plasmid map. The plasmid functions as described in the associated publication. Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin fragment contains bp# 1589-2321 of BC028920 2026-08-15 01:15:25 1
pEGFP-puro
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45561 Puromycin N-acetyl transferase Ampicillin PMID:11515370 Plasmid pEGFP-puro was constructed by PCR amplification of PuroR coding sequences from pPur (Clontech Laboratories, Palo Alto CA, USA) using upstream (5'-AAGTCCGGACTCAGATCTAGGAGACGACCTTCCATGACCGAGT-3') and downstream (5'-GTTATCTAGATCCGGTGGATCCCGGGCACCGGGCTTGCGGGTCATGCACCA-3') primers, digestion of the PCR product with BglII andBamHI, and ligation into BglII/BamHI digested pEGFP-C1 (Clontech Laboratories). To construct a fusion protein containing both EGFP and PuroR sequences, PuroR coding sequences were ligated into an existing expression cassette for EGFP. The resulting fusion protein was designated EGFP-puro and is contained in plasmid pEGFP-puro. This plasmid contains the strong human cytomegalovirus immediate early promoter (Phcmv), the EGFP puro open reading frame, and the simian virus 40 (SV40) polyadenylation signal. The EGFP-puro protein contains the first 245 amino acids of EGFP. The C-terminal five amino acids of EGFP were deleted and replaced by four linker-encoded amino acids, followed by the complete 200-amino-acid PuroR sequence. The C-terminus is formed by 11 amino acids encoded by vector sequences. The resulting fusion protein (EGFP-puro) confers both green fluorescence and resistance to puromycin when expressed in mammalian cells. Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression, Bifunctional selection protein; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 18
pBp-FGFR2c-T787K
 
Resource Report
Resource Website
RRID:Addgene_45710 FGFR2 IIIc Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin T787K 2026-08-15 01:15:26 0
pBp-FGFR2b-E471Q
 
Resource Report
Resource Website
RRID:Addgene_45703 FGFR2 IIIb Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin E471Q 2026-08-15 01:15:26 0
pBp-FGFR2b-K660E
 
Resource Report
Resource Website
RRID:Addgene_45705 FGFR2 IIIb Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin K660E 2026-08-15 01:15:26 0
pBp-FGFR2c-E471Q
 
Resource Report
Resource Website
RRID:Addgene_45704 FGFR2 IIIc Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin E471Q 2026-08-15 01:15:26 0
pBp-FGFR2b-K660N
 
Resource Report
Resource Website
RRID:Addgene_45707 FGFR2 IIIb Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin K660N 2026-08-15 01:15:26 0
pBp-FGFR2c-K660E
 
Resource Report
Resource Website
RRID:Addgene_45706 FGFR2 IIIc Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin K660E 2026-08-15 01:15:26 0
pBp-FGFR2c-K660N
 
Resource Report
Resource Website
RRID:Addgene_45708 FGFR2 IIIc Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin K660N 2026-08-15 01:15:26 0
pBp-FGFR2c-W290C
 
Resource Report
Resource Website
RRID:Addgene_45701 FGFR2 IIIc Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin W290C 2026-08-15 01:15:26 0
hE-cadherin-pcDNA3
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45769 hE-cadherin Homo sapiens Ampicillin PMID:11381089 Partial cDNA for human E-cadherin was provided by D. Rimm (Yale University, New Haven, CT) and subcloned into the pcDNA3 mammalian expression vector (Invitrogen), to generate Addgene plasmid 45772. Sequence analysis revealed that the 3′ end of the gene was missing after nucleotide 2644 (according to EMBL/GenBank/DDBJ under accession number L08599). This resulted in a truncation of the last 35 amino acids of the E-cadherin cytoplasmic domain and, as a result, did not contain the β-catenin binding region, as defined by Stappert and Kemler 1994. The COOH terminus of this truncation mutant (E-cadherin Δ β-catenin) ends at amino acid 844 (NH3-ASLSSD); the frameshift added a single histidine residue before a stop codon is introduced. The full-length human E-cadherin was reengineered using RNA from human A431 cells and the RT-PCR method (Primer A, 5′-TGACACCCGGGACAACGTTTATTA-3′, and Primer C, 5′-CTAGTCTAGACCCCTAGTGGTCCTCG-3′) to generate a 425-bp fragment encoding the missing COOH-terminal residues. This fragment was sub-cloned into the truncated hEcad-Δ 35/pcDNA3 vector (Addgene plasmid 45772) to generate full-length hEcad/pcDNA3 (Addgene plasmid 45769). Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:26 18
pBSTNAV
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45801 Ampicillin PMID:23804766 Backbone Size:3019; Vector Backbone:pBSTNAV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:26 4
α1Ic-HE2-pcDNA3
 
Resource Report
Resource Website
RRID:Addgene_45808 α1Ic Rattus norvegicus Ampicillin PMID:12297319 Backbone Marker:Perez-Reyes; Backbone Size:5400; Vector Backbone:pcDNA3-HE2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:26 0
pCMV5 alpha 1A AR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45760 alpha 1A AR Rattus norvegicus Ampicillin PMID:1970822 Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:26 1
pBabe-lincRNA-RoR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45763 lincRNA-RoR cDNA Homo sapiens Ampicillin PMID:21057500 Note that though there are some small discrepancies between Addgene's quality control sequence and the depositor's assembled sequence, they do not affect function. Backbone Marker:Bob Weinberg; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:26 3
pLKO.1-lincRNA-RoR-sh1 (Linc-sh1)
 
Resource Report
Resource Website
RRID:Addgene_45764 lincRNA-RoR-shRNA1 Homo sapiens Ampicillin PMID:21057500 Backbone Marker:Bob Weinberg; Backbone Size:7032; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:15:26 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.