Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLKO.1P shNFS1_4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_102966 | shNFS1_4 | Homo sapiens | Ampicillin | PMID:29168506 | TRCN0000180881 | Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:27 | 1 | |
|
pUDE724 Resource Report Resource Website 1+ mentions |
RRID:Addgene_103023 | crPDR12-3.S | Saccharomyces cerevisiae | Ampicillin | PMID:29106617 | Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:28 | 1 | ||
|
pUDE735 Resource Report Resource Website 1+ mentions |
RRID:Addgene_103024 | crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S | Saccharomyces cerevisiae | Ampicillin | PMID:29106617 | Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:28 | 2 | ||
|
pUDE714 Resource Report Resource Website 1+ mentions |
RRID:Addgene_103021 | crHIS4-4.S | Saccharomyces cerevisiae | Ampicillin | PMID:29106617 | Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:28 | 1 | ||
|
pUDE710 Resource Report Resource Website 1+ mentions |
RRID:Addgene_103020 | crADE2-3.crHIS4-4.S | Saccharomyces cerevisiae | Ampicillin | PMID:29106617 | Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:28 | 2 | ||
|
pLKO.1P shSOD2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_102976 | shSOD2 | Homo sapiens | Ampicillin | PMID:29168506 | TRCN0000005943 | Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:28 | 2 | |
|
pLKO.1P shISCU Resource Report Resource Website 1+ mentions |
RRID:Addgene_102972 | shISCU | Homo sapiens | Ampicillin | PMID:29168506 | TRCN0000289988 | Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO_TRC005; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:00:27 | 2 | |
|
LSB-hsa-miR-126-3p Resource Report Resource Website 1+ mentions |
RRID:Addgene_103192 | hsa-miR-126-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:29 | 1 | |
|
pUC19-Q73QW6 Resource Report Resource Website 50+ mentions |
RRID:Addgene_103130 | Q73QW6(Cas9 coding gene from Streptococcus mutans serotype c (strain ATCC 700610 / UA159)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-08-15 01:00:29 | 70 | |
|
pcDNA3.1-GcACR_457-EYFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_103137 | Anion channelrhodopsin GcACR_457 | Geminigera cryophila | Ampicillin | PMID:28256618 | Backbone Marker:Invitrogen; Backbone Size:6217; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | human codon optimized | 2026-08-15 01:00:29 | 1 | |
|
LSB-hsa-miR-132-3p Resource Report Resource Website 1+ mentions |
RRID:Addgene_103219 | hsa-miR-132-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:30 | 1 | |
|
Tom20-CR Resource Report Resource Website 1+ mentions |
RRID:Addgene_171461 | Tom20 (1-34 aa)-ECFP-FRB (2021-2113 aa) | Homo sapiens | Kanamycin | PMID:35475143 | Backbone Size:4700; Vector Backbone:pECFP-C1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:17 | 2 | ||
|
pAW-NbVHH05-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_171570 | NbVHH05-GFP | Homo sapiens | Ampicillin | PMID:35076390 | Please visit https://www.biorxiv.org/content/10.1101/2021.04.16.440240v1 for BioRxiv preprint. | Vector Backbone:pAW; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:18 | 2 | |
|
pGEMHE-H2B-mClover3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_171489 | H2B | Homo sapiens | Ampicillin | PMID:33964210 | Vector Backbone:pGEHME; Vector Types:pGEHME; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:16 | 1 | ||
|
V48 pCS2+mRFP-N1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_17143 | Ampicillin | Notes for Use: For making amino-terminal mRFP fusion protein, reading frame 1, in vector CS2+. Made by: Jeff Miller. | Backbone Marker:Moon Lab; Backbone Size:0; Vector Backbone:pCS2+mRFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:17 | 1 | ||||
|
3.8NBetaT-CAT Resource Report Resource Website 1+ mentions |
RRID:Addgene_17146 | Beta-tubulin promoter | Xenopus laevis | Ampicillin | Constructed Rebecca Beach and Paul A. Kreig. 3.8Kb fragment of the Xenopus neural Beta-tubulin promoter inserted (in several cloning steps) into the CAT expression vector pBLCAT3. The 5' end of the neural Beta-tubulin sequence is defined by the natural Xba1 site that occurs in the genomic DNA. The 3' end of the insert is produced by PCR primer located 8bp upstream of hte initiation ATP and 120bp downstream of the transcription start site. The neural Beta-tubulin sequences may be excised as a Hind3 fragment. | Backbone Marker:ATCC; Backbone Size:4300; Vector Backbone:pBLCAT3; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:16 | 1 | ||
|
M11 Cardiac Actin Promoter pCarA Resource Report Resource Website 1+ mentions |
RRID:Addgene_17148 | cardiac actin promoter | Xenopus laevis | Ampicillin | Plasmid History: Constructed by Enrique Amaya. Note for Use: Constructed by cloning the 3270bp KpnI-SalI fragment from DNA#254 (from Tim Mohun) into KpnI-SalI digested pCSKA. | Backbone Size:4000; Vector Backbone:pCSKA; Vector Types:Xenopus expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:18 | 1 | ||
|
MBP-TSF-TEVcs-ULK1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_171416 | ULK1 | Synthetic | Ampicillin | PMID:33893090 | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:16 | 1 | ||
|
Lenti-human-UBDUB-gRNA-puromycin-IRES-CFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_171531 | UBDUB gRNA | Homo sapiens | Ampicillin | PMID:37036970 | Backbone Marker:addgene: #52963; Vector Backbone:LentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:18 | 2 | ||
|
WIPI2d-TEVcs-TSF Resource Report Resource Website 1+ mentions |
RRID:Addgene_171419 | WIPI2d | Homo sapiens | Ampicillin | PMID:33893090 | Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:16 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
