Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: shNFS1_4
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000180881
Proper citation: RRID:Addgene_102966 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: crPDR12-3.S
Vector Backbone Description: Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29106617
Proper citation: RRID:Addgene_103023 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S
Vector Backbone Description: Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29106617
Proper citation: RRID:Addgene_103024 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: crHIS4-4.S
Vector Backbone Description: Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29106617
Proper citation: RRID:Addgene_103021 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: crADE2-3.crHIS4-4.S
Vector Backbone Description: Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29106617
Proper citation: RRID:Addgene_103020 Copy
Species: Homo sapiens
Genetic Insert: shSOD2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000005943
Proper citation: RRID:Addgene_102976 Copy
Species: Homo sapiens
Genetic Insert: shISCU
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO_TRC005; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000289988
Proper citation: RRID:Addgene_102972 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-126-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103192 Copy
Species: Other
Genetic Insert: Q73QW6(Cas9 coding gene from Streptococcus mutans serotype c (strain ATCC 700610 / UA159))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103130 Copy
Species: Geminigera cryophila
Genetic Insert: Anion channelrhodopsin GcACR_457
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6217; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28256618
Proper citation: RRID:Addgene_103137 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-132-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103219 Copy
Species: Homo sapiens
Genetic Insert: Tom20 (1-34 aa)-ECFP-FRB (2021-2113 aa)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pECFP-C1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35475143
Proper citation: RRID:Addgene_171461 Copy
Species: Homo sapiens
Genetic Insert: NbVHH05-GFP
Vector Backbone Description: Vector Backbone:pAW; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35076390
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.04.16.440240v1 for BioRxiv preprint.
Proper citation: RRID:Addgene_171570 Copy
Species: Homo sapiens
Genetic Insert: H2B
Vector Backbone Description: Vector Backbone:pGEHME; Vector Types:pGEHME; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33964210
Proper citation: RRID:Addgene_171489 Copy
Vector Backbone Description: Backbone Marker:Moon Lab; Backbone Size:0; Vector Backbone:pCS2+mRFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Notes for Use:
For making amino-terminal mRFP fusion protein, reading frame 1, in vector CS2+.
Made by: Jeff Miller.
Proper citation: RRID:Addgene_17143 Copy
Species: Xenopus laevis
Genetic Insert: Beta-tubulin promoter
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4300; Vector Backbone:pBLCAT3; Vector Types:; Bacterial Resistance:Ampicillin
Comments: Constructed Rebecca Beach and Paul A. Kreig.
3.8Kb fragment of the Xenopus neural Beta-tubulin promoter inserted (in several cloning steps) into the CAT expression vector pBLCAT3. The 5' end of the neural Beta-tubulin sequence is defined by the natural Xba1 site that occurs in the genomic DNA. The 3' end of the insert is produced by PCR primer located 8bp upstream of hte initiation ATP and 120bp downstream of the transcription start site. The neural Beta-tubulin sequences may be excised as a Hind3 fragment.
Proper citation: RRID:Addgene_17146 Copy
Species: Xenopus laevis
Genetic Insert: cardiac actin promoter
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCSKA; Vector Types:Xenopus expression; Bacterial Resistance:Ampicillin
Comments: Plasmid History:
Constructed by Enrique Amaya.
Note for Use:
Constructed by cloning the 3270bp KpnI-SalI fragment from DNA#254 (from Tim Mohun) into KpnI-SalI digested pCSKA.
Proper citation: RRID:Addgene_17148 Copy
Species: Synthetic
Genetic Insert: ULK1
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33893090
Proper citation: RRID:Addgene_171416 Copy
Species: Homo sapiens
Genetic Insert: UBDUB gRNA
Vector Backbone Description: Backbone Marker:addgene: #52963; Vector Backbone:LentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37036970
Proper citation: RRID:Addgene_171531 Copy
Species: Homo sapiens
Genetic Insert: WIPI2d
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33893090
Proper citation: RRID:Addgene_171419 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
