Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pEX.sEF1a.Kozak.HA.NLS.Sce.T2A.BFP Resource Report Resource Website |
RRID:Addgene_45565 | I-Sce I Nuclease | Homo sapiens | Ampicillin | PMID:24121685 | Backbone Size:3724; Vector Backbone:pExodus; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 0 | ||
|
pIRES-EGFP-puro Resource Report Resource Website 10+ mentions |
RRID:Addgene_45567 | Ampicillin | Plasmid pIRES-EGFP-puro was constructed containing the Phcmv promoter followed by unique restriction sites (NheI, XhoI, and SacI) for insertion of genes. Downstream, an IRES from the encephalomyocarditis virus directs the translation of EGFP-puro from the same mRNA. Addgene's sequencing results found differences compared to the depositing lab's sequence in the 3' region of the puro resistance marker. The resulting protein sequence matches NCBI WP_055528321.1 and should be functional. | Backbone Marker:Clontech; Backbone Size:5729; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 24 | ||||
|
pCRII-Topo Crim1 in situ probe Resource Report Resource Website |
RRID:Addgene_45600 | Crim1 in situ probe | Mus musculus | Ampicillin | PMID:15664173 | Fragment was amplified using the following primers: TCTCAAGACTGTTGGTTGCTG TGAACAACCAATGATAGCACAG For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp#4062-4502 of NM_015800.3, not bp# 4708-5148 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | insert contains bp#4062-4502 of NM_015800.3 | 2026-08-15 01:15:25 | 0 |
|
pKH3-TRIM28 Resource Report Resource Website 10+ mentions |
RRID:Addgene_45569 | TRIM28 | Homo sapiens | Ampicillin | PMID:21940674 | Full-length human TRIM28 was purchased from Origene and subcloned into vector pKH3 to generate pKH3-Trim28. | Backbone Marker:Addgene plasmid Plasmid 12555; Backbone Size:4800; Vector Backbone:pKH3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 11 | |
|
pCRII-Topo Diap3 in situ probe Resource Report Resource Website 1+ mentions |
RRID:Addgene_45602 | Diap3 in situ probe | Mus musculus | Ampicillin | PMID:15664173 | Fragment was amplified using the following primers: AGCAGTTCGCTGTTGTGATG GCACGTTTCTCCTTTTCTGC For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1589-2321 of BC028920, not bp# 1610-2321 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 1589-2321 of BC028920 | 2026-08-15 01:15:25 | 1 |
|
pEGFP-puro Resource Report Resource Website 10+ mentions |
RRID:Addgene_45561 | Puromycin N-acetyl transferase | Ampicillin | PMID:11515370 | Plasmid pEGFP-puro was constructed by PCR amplification of PuroR coding sequences from pPur (Clontech Laboratories, Palo Alto CA, USA) using upstream (5'-AAGTCCGGACTCAGATCTAGGAGACGACCTTCCATGACCGAGT-3') and downstream (5'-GTTATCTAGATCCGGTGGATCCCGGGCACCGGGCTTGCGGGTCATGCACCA-3') primers, digestion of the PCR product with BglII andBamHI, and ligation into BglII/BamHI digested pEGFP-C1 (Clontech Laboratories). To construct a fusion protein containing both EGFP and PuroR sequences, PuroR coding sequences were ligated into an existing expression cassette for EGFP. The resulting fusion protein was designated EGFP-puro and is contained in plasmid pEGFP-puro. This plasmid contains the strong human cytomegalovirus immediate early promoter (Phcmv), the EGFP puro open reading frame, and the simian virus 40 (SV40) polyadenylation signal. The EGFP-puro protein contains the first 245 amino acids of EGFP. The C-terminal five amino acids of EGFP were deleted and replaced by four linker-encoded amino acids, followed by the complete 200-amino-acid PuroR sequence. The C-terminus is formed by 11 amino acids encoded by vector sequences. The resulting fusion protein (EGFP-puro) confers both green fluorescence and resistance to puromycin when expressed in mammalian cells. | Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression, Bifunctional selection protein; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 18 | ||
|
pBp-FGFR2c-T787K Resource Report Resource Website |
RRID:Addgene_45710 | FGFR2 IIIc | Homo sapiens | Ampicillin | PMID:23786770 | Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | T787K | 2026-08-15 01:15:26 | 0 | |
|
pBp-FGFR2b-E471Q Resource Report Resource Website |
RRID:Addgene_45703 | FGFR2 IIIb | Homo sapiens | Ampicillin | PMID:23786770 | Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | E471Q | 2026-08-15 01:15:26 | 0 | |
|
pBp-FGFR2b-K660E Resource Report Resource Website |
RRID:Addgene_45705 | FGFR2 IIIb | Homo sapiens | Ampicillin | PMID:23786770 | Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | K660E | 2026-08-15 01:15:26 | 0 | |
|
pBp-FGFR2c-E471Q Resource Report Resource Website |
RRID:Addgene_45704 | FGFR2 IIIc | Homo sapiens | Ampicillin | PMID:23786770 | Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | E471Q | 2026-08-15 01:15:26 | 0 | |
|
pBp-FGFR2b-K660N Resource Report Resource Website |
RRID:Addgene_45707 | FGFR2 IIIb | Homo sapiens | Ampicillin | PMID:23786770 | Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | K660N | 2026-08-15 01:15:26 | 0 | |
|
pBp-FGFR2c-K660E Resource Report Resource Website |
RRID:Addgene_45706 | FGFR2 IIIc | Homo sapiens | Ampicillin | PMID:23786770 | Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | K660E | 2026-08-15 01:15:26 | 0 | |
|
pBp-FGFR2c-K660N Resource Report Resource Website |
RRID:Addgene_45708 | FGFR2 IIIc | Homo sapiens | Ampicillin | PMID:23786770 | Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | K660N | 2026-08-15 01:15:26 | 0 | |
|
pBp-FGFR2c-W290C Resource Report Resource Website |
RRID:Addgene_45701 | FGFR2 IIIc | Homo sapiens | Ampicillin | PMID:23786770 | Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | W290C | 2026-08-15 01:15:26 | 0 | |
|
hE-cadherin-pcDNA3 Resource Report Resource Website 10+ mentions |
RRID:Addgene_45769 | hE-cadherin | Homo sapiens | Ampicillin | PMID:11381089 | Partial cDNA for human E-cadherin was provided by D. Rimm (Yale University, New Haven, CT) and subcloned into the pcDNA3 mammalian expression vector (Invitrogen), to generate Addgene plasmid 45772. Sequence analysis revealed that the 3′ end of the gene was missing after nucleotide 2644 (according to EMBL/GenBank/DDBJ under accession number L08599). This resulted in a truncation of the last 35 amino acids of the E-cadherin cytoplasmic domain and, as a result, did not contain the β-catenin binding region, as defined by Stappert and Kemler 1994. The COOH terminus of this truncation mutant (E-cadherin Δ β-catenin) ends at amino acid 844 (NH3-ASLSSD); the frameshift added a single histidine residue before a stop codon is introduced. The full-length human E-cadherin was reengineered using RNA from human A431 cells and the RT-PCR method (Primer A, 5′-TGACACCCGGGACAACGTTTATTA-3′, and Primer C, 5′-CTAGTCTAGACCCCTAGTGGTCCTCG-3′) to generate a 425-bp fragment encoding the missing COOH-terminal residues. This fragment was sub-cloned into the truncated hEcad-Δ 35/pcDNA3 vector (Addgene plasmid 45772) to generate full-length hEcad/pcDNA3 (Addgene plasmid 45769). | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 18 | |
|
pBSTNAV Resource Report Resource Website 1+ mentions |
RRID:Addgene_45801 | Ampicillin | PMID:23804766 | Backbone Size:3019; Vector Backbone:pBSTNAV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 4 | ||||
|
α1Ic-HE2-pcDNA3 Resource Report Resource Website |
RRID:Addgene_45808 | α1Ic | Rattus norvegicus | Ampicillin | PMID:12297319 | Backbone Marker:Perez-Reyes; Backbone Size:5400; Vector Backbone:pcDNA3-HE2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 0 | ||
|
pCMV5 alpha 1A AR Resource Report Resource Website 1+ mentions |
RRID:Addgene_45760 | alpha 1A AR | Rattus norvegicus | Ampicillin | PMID:1970822 | Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | ||
|
pBabe-lincRNA-RoR Resource Report Resource Website 1+ mentions |
RRID:Addgene_45763 | lincRNA-RoR cDNA | Homo sapiens | Ampicillin | PMID:21057500 | Note that though there are some small discrepancies between Addgene's quality control sequence and the depositor's assembled sequence, they do not affect function. | Backbone Marker:Bob Weinberg; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 3 | |
|
pLKO.1-lincRNA-RoR-sh1 (Linc-sh1) Resource Report Resource Website |
RRID:Addgene_45764 | lincRNA-RoR-shRNA1 | Homo sapiens | Ampicillin | PMID:21057500 | Backbone Marker:Bob Weinberg; Backbone Size:7032; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.