Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: calcium channel alpha-1B subunit
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA6/V5-His ABC; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9010213
Comments: Isolated from superior cervical ganglia.
For more information about this plasmid: http://neuroscience.brown.edu/LipscombeLab/homepage/otherpages/clonespage/clonespage1.htm
Also see: GENBANK AF222337
Proper citation: RRID:Addgene_26571 Copy
Species: Rattus norvegicus
Genetic Insert: I-SceI-GRLBD
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-Monomer-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17486118
Comments: The Ligand Binding
Domain (LBD) of GR was amplified from pCI-nGFP-C656G GR (gift from G. Hager) and cloned into pEGFP-C2
(Clontech) in the SacII and BamHI sites. The C656G mutation of GR that makes it more responsive to ligand and
trasnfers it more quickly to the nucleus. Similarly, the I-SceI cDNA was amplified from HA-I-SceI and cloned into the previously described
GFP-GRLBD into the SacI and SalI restriction sites. Finally, the chimeric I-SceI–GR cDNA was subcloned into pDsRed-Monomer-C1 (Clontech) into the SacI and BamHI sites.
Proper citation: RRID:Addgene_17654 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8m
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_176757 Copy
Species: Rattus norvegicus
Genetic Insert: lck-jGCaMP8f
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_176759 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8s
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_176758 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8s
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_176752 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8s
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_176755 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8m
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_176754 Copy
Species: Rattus norvegicus
Genetic Insert: H2B-jGCaMP8s
Vector Backbone Description: Vector Backbone:AAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_176749 Copy
Species: Rattus norvegicus
Genetic Insert: p47
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pTrcHisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15371428
Proper citation: RRID:Addgene_21268 Copy
Species: Rattus norvegicus
Genetic Insert: Npl4
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3000; Vector Backbone:pET30; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15371428
Proper citation: RRID:Addgene_21267 Copy
Species: Rattus norvegicus
Genetic Insert: rho/rac guanine nucleotide exchange factor (GEF) 2
Vector Backbone Description: Backbone Marker:Available from Addgene (#14883); Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19208802
Proper citation: RRID:Addgene_21477 Copy
Species: Rattus norvegicus
Genetic Insert: Dazl
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4911; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Day 25 cDNA TD197b/TD198.
Dazl sequence was determined and designed based on coding sequence available for rat genome in 2003. There may be a few discrepancies with the currently available sequence, most notably a C-terminal truncation and point mutation causing P196S.
Proper citation: RRID:Addgene_21623 Copy
Species: Rattus norvegicus
Genetic Insert: Dazl shRNA-2
Vector Backbone Description: Backbone Size:8264; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Comments: Dazl shRNA sequence is - 5'-TTTGTTGATCCAGGAGCTGACCTTCAAGAGAGGTCAGCTCCTGGATCAACTTTT
Proper citation: RRID:Addgene_21622 Copy
Species: Rattus norvegicus
Genetic Insert: mitogen-activated protein kinase kinase kinase 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:10400; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7624324
Comments: full length MEKK1
Proper citation: RRID:Addgene_21632 Copy
Species: Rattus norvegicus
Genetic Insert: mTOR (1750-2549)
Vector Backbone Description: Backbone Marker:BD Pharmingen; Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12718876
Proper citation: RRID:Addgene_21747 Copy
Species: Rattus norvegicus
Genetic Insert: mTOR (1-1482)
Vector Backbone Description: Backbone Marker:BD Pharmingen; Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12718876
Proper citation: RRID:Addgene_21745 Copy
Species: Rattus norvegicus
Genetic Insert: bJunVN173
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4646; Vector Backbone:pFLAG-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16454041
Proper citation: RRID:Addgene_22012 Copy
Species: Rattus norvegicus
Genetic Insert: bFosVC155
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3759; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16454041
Proper citation: RRID:Addgene_22013 Copy
Species: Rattus norvegicus
Genetic Insert: bFosDelataZIPVC155
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3756; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16454041
Proper citation: RRID:Addgene_22014 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
