Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
EcNR2.dnaG.Q576A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_41700 E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] dnaG.Q576A Ampicillin PMID:22904085 Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:47 3
pAAH4
 
Resource Report
Resource Website
RRID:Addgene_41828 Ampicillin PMID:21393538 Backbone Size:3580; Vector Backbone:pUG66; Vector Types:Yeast Expression, PCR template; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
hCas9
 
Resource Report
Resource Website
100+ mentions
RRID:Addgene_41815 Cas9 Ampicillin PMID:23287722 For additional information: http://arep.med.harvard.edu/human_crispr/ Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin human codon-optimized 2026-08-15 01:14:48 453
pCE-hSK
 
Resource Report
Resource Website
50+ mentions
RRID:Addgene_41814 SOX2, KLF4 Homo sapiens Ampicillin PMID:23193063 Backbone Size:9364; Vector Backbone:pCE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 50
H9 pMalLP
 
Resource Report
Resource Website
RRID:Addgene_41811 H9 Super-2 Homo sapiens Ampicillin PMID:22446627 This is an e. coli periplasmic expression vector. H9 has the following mutations compared to wildtype IL-2: L80F, R81F, L85V, I86V, I92F Backbone Size:6700; Vector Backbone:pMalLP; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
IL2 F42A pAcGP67a
 
Resource Report
Resource Website
RRID:Addgene_41807 IL2 Homo sapiens Ampicillin PMID:22446627 Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Phenylalanine 42 to Alanine 2026-08-15 01:14:48 0
IL2 pAcGP67a
 
Resource Report
Resource Website
RRID:Addgene_41806 IL2 Homo sapiens Ampicillin PMID:22446627 Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
pDM8
 
Resource Report
Resource Website
RRID:Addgene_41758 kinesin heavy chain Drosophila melanogaster Ampicillin PMID:20212149 Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin residues 1-401; C45S C338S S364C C451S 2026-08-15 01:14:48 0
pAP2
 
Resource Report
Resource Website
RRID:Addgene_41755 kinesin heavy chain Drosophila melanogaster Ampicillin PMID:20212149 Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin residues 1-401; C45S C338S K349C C451S 2026-08-15 01:14:48 0
pOU1
 
Resource Report
Resource Website
RRID:Addgene_41753 kinesin heavy chain Drosophila melanogaster Ampicillin PMID:20212149 Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin residues 1-401; C338S C451S 2026-08-15 01:14:48 0
HA-EGFP-HaloTag2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_41742 Halotag 2 Homo sapiens Ampicillin PMID:21725302 Alternate plasmid name: pCDNA5-KGH2 Backbone Marker:INVITROGEN; Backbone Size:5000; Vector Backbone:PCDNA5; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 5
pSR-siKlf5
 
Resource Report
Resource Website
RRID:Addgene_41740 Klf5 Mus musculus Ampicillin PMID:17158781 Backbone Marker:Oligoengine; Vector Backbone:pSuper-Retro; Vector Types:RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
Nuc5-.dnaG.Q576A.tolC-
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_41699 E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] xonA-, recJ-,xseA-, exoX- and redα- dnaG.Q576A tolC- Ampicillin PMID:22904085 Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:47 1
pCS2 Notch1 LNG (CC→SS)-6MT
 
Resource Report
Resource Website
RRID:Addgene_41739 Notch-1 Lin-Notch-glp (LNG) repeat-containing construct, CC->SS Mus musculus Ampicillin PMID:10882062 Alternate plasmid name: pCS2 NLNR CC>SS-6MT All Notch1 constructs deposited here were cloned into the pCS2+MT vector (Rupp et al., 1994; Turner and Weintraub, 1994) and have the C-terminal 348 residues (aa 2185 to C terminus) of Notch replaced with a hexameric myc tag to facilitate biochemical analysis. PCR mutagenesis was used to create the C1675S and C1682S mutations in LNR (Addgene plasmid #41738). Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Contains murine Notch-1 leader peptide (aa 1-23) and then protein from the extracellular lin-Notch-glp (LNG) repeats to residue 2184 (aa 1448-2184); C1675S, C1682S 2026-08-15 01:14:48 0
pCS2 Notch1 ICv-6MT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_41730 Notch-1 Intracellular Domain Mus musculus Ampicillin PMID:9620803 Alternate plasmid name: pCS2 NICv1744-6MT To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737). Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Contains murine Notch-1 protein beginning at Valine 1744 (aa 1744-2184) 2026-08-15 01:14:47 3
psiCheck-DNAJA43'UTR
 
Resource Report
Resource Website
RRID:Addgene_41847 DNAJA4 3'UTR Homo sapiens Ampicillin PMID:23142051 Full-length 3′UTR of DNAJA4 was cloned downstream of a renilla luciferase reporter into the psiCheck2 dual luciferase reporter vector Backbone Marker:Promega; Backbone Size:6200; Vector Backbone:psiCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
pBABE puro Brca1 S1423A S1524A HA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_41968 BRCA1 Homo sapiens Ampicillin PMID:10550055 The BRCA1 insert in this plasmid contains the following common polymorphisms when compared to GenBank reference sequence NP_009225.1: P871L, E1038G, K1182R, and S1613G. These SNPs were likely present in the original cDNA isolate. Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin S1423A, S1524A 2026-08-15 01:14:49 1
psiCheck-ApoE3'UTR
 
Resource Report
Resource Website
RRID:Addgene_41846 ApoE 3'UTR Homo sapiens Ampicillin PMID:23142051 Full-length 3′UTR of ApoE was cloned downstream of renilla luciferase reporter in the psiCheck2 dual luciferase reporter vector Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
pCT302
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_41845 4-4-20 Synthetic Ampicillin PMID:15465055 Backbone Size:6142; Vector Backbone:pCT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 6
pCT-4M5.3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_41844 4M5.3 Synthetic Ampicillin PMID:15465055 Backbone Size:6142; Vector Backbone:pCT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.