Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
EcNR2.dnaG.Q576A Resource Report Resource Website 1+ mentions |
RRID:Addgene_41700 | E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] dnaG.Q576A | Ampicillin | PMID:22904085 | Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:47 | 3 | |||
|
pAAH4 Resource Report Resource Website |
RRID:Addgene_41828 | Ampicillin | PMID:21393538 | Backbone Size:3580; Vector Backbone:pUG66; Vector Types:Yeast Expression, PCR template; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 0 | ||||
|
hCas9 Resource Report Resource Website 100+ mentions |
RRID:Addgene_41815 | Cas9 | Ampicillin | PMID:23287722 | For additional information: http://arep.med.harvard.edu/human_crispr/ | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-08-15 01:14:48 | 453 | |
|
pCE-hSK Resource Report Resource Website 50+ mentions |
RRID:Addgene_41814 | SOX2, KLF4 | Homo sapiens | Ampicillin | PMID:23193063 | Backbone Size:9364; Vector Backbone:pCE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 50 | ||
|
H9 pMalLP Resource Report Resource Website |
RRID:Addgene_41811 | H9 Super-2 | Homo sapiens | Ampicillin | PMID:22446627 | This is an e. coli periplasmic expression vector. H9 has the following mutations compared to wildtype IL-2: L80F, R81F, L85V, I86V, I92F | Backbone Size:6700; Vector Backbone:pMalLP; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 0 | |
|
IL2 F42A pAcGP67a Resource Report Resource Website |
RRID:Addgene_41807 | IL2 | Homo sapiens | Ampicillin | PMID:22446627 | Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Phenylalanine 42 to Alanine | 2026-08-15 01:14:48 | 0 | |
|
IL2 pAcGP67a Resource Report Resource Website |
RRID:Addgene_41806 | IL2 | Homo sapiens | Ampicillin | PMID:22446627 | Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 0 | ||
|
pDM8 Resource Report Resource Website |
RRID:Addgene_41758 | kinesin heavy chain | Drosophila melanogaster | Ampicillin | PMID:20212149 | Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | residues 1-401; C45S C338S S364C C451S | 2026-08-15 01:14:48 | 0 | |
|
pAP2 Resource Report Resource Website |
RRID:Addgene_41755 | kinesin heavy chain | Drosophila melanogaster | Ampicillin | PMID:20212149 | Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | residues 1-401; C45S C338S K349C C451S | 2026-08-15 01:14:48 | 0 | |
|
pOU1 Resource Report Resource Website |
RRID:Addgene_41753 | kinesin heavy chain | Drosophila melanogaster | Ampicillin | PMID:20212149 | Vector Backbone:pT7-7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | residues 1-401; C338S C451S | 2026-08-15 01:14:48 | 0 | |
|
HA-EGFP-HaloTag2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_41742 | Halotag 2 | Homo sapiens | Ampicillin | PMID:21725302 | Alternate plasmid name: pCDNA5-KGH2 | Backbone Marker:INVITROGEN; Backbone Size:5000; Vector Backbone:PCDNA5; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 5 | |
|
pSR-siKlf5 Resource Report Resource Website |
RRID:Addgene_41740 | Klf5 | Mus musculus | Ampicillin | PMID:17158781 | Backbone Marker:Oligoengine; Vector Backbone:pSuper-Retro; Vector Types:RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 0 | ||
|
Nuc5-.dnaG.Q576A.tolC- Resource Report Resource Website 1+ mentions |
RRID:Addgene_41699 | E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] xonA-, recJ-,xseA-, exoX- and redα- dnaG.Q576A tolC- | Ampicillin | PMID:22904085 | Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:47 | 1 | |||
|
pCS2 Notch1 LNG (CC→SS)-6MT Resource Report Resource Website |
RRID:Addgene_41739 | Notch-1 Lin-Notch-glp (LNG) repeat-containing construct, CC->SS | Mus musculus | Ampicillin | PMID:10882062 | Alternate plasmid name: pCS2 NLNR CC>SS-6MT All Notch1 constructs deposited here were cloned into the pCS2+MT vector (Rupp et al., 1994; Turner and Weintraub, 1994) and have the C-terminal 348 residues (aa 2185 to C terminus) of Notch replaced with a hexameric myc tag to facilitate biochemical analysis. PCR mutagenesis was used to create the C1675S and C1682S mutations in LNR (Addgene plasmid #41738). | Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Contains murine Notch-1 leader peptide (aa 1-23) and then protein from the extracellular lin-Notch-glp (LNG) repeats to residue 2184 (aa 1448-2184); C1675S, C1682S | 2026-08-15 01:14:48 | 0 |
|
pCS2 Notch1 ICv-6MT Resource Report Resource Website 1+ mentions |
RRID:Addgene_41730 | Notch-1 Intracellular Domain | Mus musculus | Ampicillin | PMID:9620803 | Alternate plasmid name: pCS2 NICv1744-6MT To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737). | Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Contains murine Notch-1 protein beginning at Valine 1744 (aa 1744-2184) | 2026-08-15 01:14:47 | 3 |
|
psiCheck-DNAJA43'UTR Resource Report Resource Website |
RRID:Addgene_41847 | DNAJA4 3'UTR | Homo sapiens | Ampicillin | PMID:23142051 | Full-length 3′UTR of DNAJA4 was cloned downstream of a renilla luciferase reporter into the psiCheck2 dual luciferase reporter vector | Backbone Marker:Promega; Backbone Size:6200; Vector Backbone:psiCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 0 | |
|
pBABE puro Brca1 S1423A S1524A HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_41968 | BRCA1 | Homo sapiens | Ampicillin | PMID:10550055 | The BRCA1 insert in this plasmid contains the following common polymorphisms when compared to GenBank reference sequence NP_009225.1: P871L, E1038G, K1182R, and S1613G. These SNPs were likely present in the original cDNA isolate. | Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | S1423A, S1524A | 2026-08-15 01:14:49 | 1 |
|
psiCheck-ApoE3'UTR Resource Report Resource Website |
RRID:Addgene_41846 | ApoE 3'UTR | Homo sapiens | Ampicillin | PMID:23142051 | Full-length 3′UTR of ApoE was cloned downstream of renilla luciferase reporter in the psiCheck2 dual luciferase reporter vector | Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 0 | |
|
pCT302 Resource Report Resource Website 1+ mentions |
RRID:Addgene_41845 | 4-4-20 | Synthetic | Ampicillin | PMID:15465055 | Backbone Size:6142; Vector Backbone:pCT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 6 | ||
|
pCT-4M5.3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_41844 | 4M5.3 | Synthetic | Ampicillin | PMID:15465055 | Backbone Size:6142; Vector Backbone:pCT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.