Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:caenorhabditis elegans (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,881 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pGC381
 
Resource Report
Resource Website
RRID:Addgene_19663 <*-CFP::let-858(3’) Caenorhabditis elegans Ampicillin PMID:18723890 Backbone Size:0; Vector Backbone:pGC307; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin 2026-08-15 01:11:47 0
pGC307
 
Resource Report
Resource Website
RRID:Addgene_19662 <*iA-1xNLS-CFP::let-858(3’) Caenorhabditis elegans Ampicillin PMID:18723890 Backbone Size:0; Vector Backbone:pGC294; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin 2026-08-15 01:11:47 0
pGC382
 
Resource Report
Resource Website
RRID:Addgene_19667 <*-YFP::let-858(3’) Caenorhabditis elegans Ampicillin PMID:18723890 Backbone Size:0; Vector Backbone:pGC308; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin 2026-08-15 01:11:47 0
pGC308
 
Resource Report
Resource Website
RRID:Addgene_19666 <*iA-1xNLS-YFP::let-858(3’) Caenorhabditis elegans Ampicillin PMID:18723890 Backbone Size:0; Vector Backbone:pGC295; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin 2026-08-15 01:11:47 0
pGC302
 
Resource Report
Resource Website
RRID:Addgene_19668 <*iA-4xNLS-mCherry::let-858(3’) Caenorhabditis elegans Ampicillin PMID:18723890 Backbone Size:0; Vector Backbone:pGC292; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin 2026-08-15 01:11:47 0
pCCM935
 
Resource Report
Resource Website
RRID:Addgene_58202 unc-22 sgRNA Caenorhabditis elegans Kanamycin PMID:24879462 gRNA target sequence GAACCCGTTGCCGAATACAC Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:14 0
pET28-ceRab21(1-207)
 
Resource Report
Resource Website
RRID:Addgene_59554 1-207 Caenorhabditis elegans Ampicillin PMID:20462958 Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:17:23 0
pET28-ceRab5(1-208)
 
Resource Report
Resource Website
RRID:Addgene_59551 1-208 Caenorhabditis elegans Ampicillin PMID:20462958 Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:17:23 0
pET28-ceRab10(1-201)
 
Resource Report
Resource Website
RRID:Addgene_59552 1-208 Caenorhabditis elegans Ampicillin PMID:20462958 Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:17:23 0
pSA107
 
Resource Report
Resource Website
RRID:Addgene_59785 cdc-42 promoter Caenorhabditis elegans Ampicillin PMID:25377555 Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:26 0
pSA109
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_59783 elt-2 promoter Caenorhabditis elegans Ampicillin PMID:25377555 Vector Backbone:pCFJ150; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:17:26 1
pJA50
 
Resource Report
Resource Website
RRID:Addgene_59931 unc-58(e665) gRNA Caenorhabditis elegans Kanamycin PMID:25161212 Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:27 0
pJA42
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_59930 rol-6(su1006) gRNA Caenorhabditis elegans Kanamycin PMID:25161212 Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:27 4
pJA58
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_59933 dpy-10(cn64) gRNA Caenorhabditis elegans Kanamycin PMID:25161212 Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:27 8
pSA120
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_59789 hsp-16.41 promoter Caenorhabditis elegans Ampicillin PMID:25377555 Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:26 1
pJA46
 
Resource Report
Resource Website
RRID:Addgene_59928 rde-1(D801) gRNA Caenorhabditis elegans Kanamycin PMID:25161212 Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:27 0
pJA14
 
Resource Report
Resource Website
RRID:Addgene_59929 rde-1(H974) gRNA Caenorhabditis elegans Kanamycin PMID:25161212 Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:27 0
pLT 651
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_59998 klp-16 Caenorhabditis elegans Ampicillin PMID:25066299 Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.) Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin partial genomic 2026-08-15 01:17:28 1
pSEZ-1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_51868 psdhb-1::mtLS-cpYFP Caenorhabditis elegans Ampicillin PMID:24522532 Backbone Marker:B. D. Lemire; Backbone Size:3470; Vector Backbone:pSDH2(P-2)GFP; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:22 1
pTL-4
 
Resource Report
Resource Website
RRID:Addgene_52033 Unc-43 Caenorhabditis elegans Ampicillin PMID:23805378 Vector Backbone:pGEX-6P; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:19 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.