Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 92 showing 1821 ~ 1840 out of 1,881 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_19663

http://www.addgene.org/19663

Species: Caenorhabditis elegans
Genetic Insert: <*-CFP::let-858(3’)
Vector Backbone Description: Backbone Size:0; Vector Backbone:pGC307; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18723890

Proper citation: RRID:Addgene_19663 Copy   


  • RRID:Addgene_19662

http://www.addgene.org/19662

Species: Caenorhabditis elegans
Genetic Insert: <*iA-1xNLS-CFP::let-858(3’)
Vector Backbone Description: Backbone Size:0; Vector Backbone:pGC294; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18723890

Proper citation: RRID:Addgene_19662 Copy   


  • RRID:Addgene_19667

http://www.addgene.org/19667

Species: Caenorhabditis elegans
Genetic Insert: <*-YFP::let-858(3’)
Vector Backbone Description: Backbone Size:0; Vector Backbone:pGC308; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18723890

Proper citation: RRID:Addgene_19667 Copy   


  • RRID:Addgene_19666

http://www.addgene.org/19666

Species: Caenorhabditis elegans
Genetic Insert: <*iA-1xNLS-YFP::let-858(3’)
Vector Backbone Description: Backbone Size:0; Vector Backbone:pGC295; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18723890

Proper citation: RRID:Addgene_19666 Copy   


  • RRID:Addgene_19668

http://www.addgene.org/19668

Species: Caenorhabditis elegans
Genetic Insert: <*iA-4xNLS-mCherry::let-858(3’)
Vector Backbone Description: Backbone Size:0; Vector Backbone:pGC292; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18723890

Proper citation: RRID:Addgene_19668 Copy   


  • RRID:Addgene_58202

http://www.addgene.org/58202

Species: Caenorhabditis elegans
Genetic Insert: unc-22 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GAACCCGTTGCCGAATACAC

Proper citation: RRID:Addgene_58202 Copy   


  • RRID:Addgene_59554

http://www.addgene.org/59554

Species: Caenorhabditis elegans
Genetic Insert: 1-207
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958

Proper citation: RRID:Addgene_59554 Copy   


  • RRID:Addgene_59551

http://www.addgene.org/59551

Species: Caenorhabditis elegans
Genetic Insert: 1-208
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958

Proper citation: RRID:Addgene_59551 Copy   


  • RRID:Addgene_59552

http://www.addgene.org/59552

Species: Caenorhabditis elegans
Genetic Insert: 1-208
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958

Proper citation: RRID:Addgene_59552 Copy   


  • RRID:Addgene_59785

http://www.addgene.org/59785

Species: Caenorhabditis elegans
Genetic Insert: cdc-42 promoter
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25377555

Proper citation: RRID:Addgene_59785 Copy   


  • RRID:Addgene_59783

    This resource has 1+ mentions.

http://www.addgene.org/59783

Species: Caenorhabditis elegans
Genetic Insert: elt-2 promoter
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25377555

Proper citation: RRID:Addgene_59783 Copy   


  • RRID:Addgene_59931

http://www.addgene.org/59931

Species: Caenorhabditis elegans
Genetic Insert: unc-58(e665) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212

Proper citation: RRID:Addgene_59931 Copy   


  • RRID:Addgene_59930

    This resource has 1+ mentions.

http://www.addgene.org/59930

Species: Caenorhabditis elegans
Genetic Insert: rol-6(su1006) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212

Proper citation: RRID:Addgene_59930 Copy   


  • RRID:Addgene_59933

    This resource has 1+ mentions.

http://www.addgene.org/59933

Species: Caenorhabditis elegans
Genetic Insert: dpy-10(cn64) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212

Proper citation: RRID:Addgene_59933 Copy   


  • RRID:Addgene_59789

    This resource has 1+ mentions.

http://www.addgene.org/59789

Species: Caenorhabditis elegans
Genetic Insert: hsp-16.41 promoter
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25377555

Proper citation: RRID:Addgene_59789 Copy   


  • RRID:Addgene_59928

http://www.addgene.org/59928

Species: Caenorhabditis elegans
Genetic Insert: rde-1(D801) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212

Proper citation: RRID:Addgene_59928 Copy   


  • RRID:Addgene_59929

http://www.addgene.org/59929

Species: Caenorhabditis elegans
Genetic Insert: rde-1(H974) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212

Proper citation: RRID:Addgene_59929 Copy   


  • RRID:Addgene_59998

    This resource has 1+ mentions.

http://www.addgene.org/59998

Species: Caenorhabditis elegans
Genetic Insert: klp-16
Vector Backbone Description: Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25066299
Comments: Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.)

Proper citation: RRID:Addgene_59998 Copy   


  • RRID:Addgene_51868

    This resource has 1+ mentions.

http://www.addgene.org/51868

Species: Caenorhabditis elegans
Genetic Insert: psdhb-1::mtLS-cpYFP
Vector Backbone Description: Backbone Marker:B. D. Lemire; Backbone Size:3470; Vector Backbone:pSDH2(P-2)GFP; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24522532

Proper citation: RRID:Addgene_51868 Copy   


  • RRID:Addgene_52033

http://www.addgene.org/52033

Species: Caenorhabditis elegans
Genetic Insert: Unc-43
Vector Backbone Description: Vector Backbone:pGEX-6P; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23805378

Proper citation: RRID:Addgene_52033 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X