Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLPCX-VEcadTL Resource Report Resource Website 1+ mentions |
RRID:Addgene_45849 | VE-cadherin | Mus musculus | Ampicillin | PMID:23684974 | Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 2 | ||
|
Tet-O-FUW-Olig2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45844 | Olig2 | Mus musculus | Ampicillin | PMID:23584610 | Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | ||
|
Tet-O-FUW-Sox10 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45843 | Sox10 | Mus musculus | Ampicillin | PMID:23584610 | Backbone Size:8377; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 3 | ||
|
TN-XXL pRSETB Resource Report Resource Website |
RRID:Addgene_45796 | TN-XXL | Gallus gallus | Ampicillin | PMID:19160515 | TN-XXL is composed of two fluorescent proteins: cyan fluorescent protein (CFP) as the FRET donor and cpCitrine as the FRET acceptor. These proteins are linked by the calcium-sensitive double C-terminal lobe of troponin C (TnC). After the binding of free calcium, TnC undergoes a reversible conformational change that leads to energy transfer from the donor to the acceptor fluorophore, resulting in a drop in CFP fluorescence and an increase in cpCitrine fluorescence. | Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 0 | |
|
pRS316-4M5.3 Resource Report Resource Website |
RRID:Addgene_45831 | 4M5.3 | Ampicillin | Backbone Size:6063; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 0 | ||||
|
pBADmod1-linker2-gamS Resource Report Resource Website 1+ mentions |
RRID:Addgene_45833 | gamS | Lambda phage | Ampicillin | PMID:24303785 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pBAD/His A; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 2 | ||
|
MG-miR125b-sponge-bulge Resource Report Resource Website 1+ mentions |
RRID:Addgene_45790 | miR125b sponge | Ampicillin | PMID:22366319 | Vector Backbone:MSCV EGFP (MG vector); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 2 | |||
|
pMSCV-puro-Delta-ATG1-mMCL1 Resource Report Resource Website |
RRID:Addgene_45823 | Delta ATG1-mMCL1 | Mus musculus | Ampicillin | PMID:22544066 | Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | The first amino acid (ATG) is deleted from the full length mouse MCL-1 | 2026-08-15 01:15:26 | 0 | |
|
pCM62 Resource Report Resource Website |
RRID:Addgene_45826 | Tetracycline | PMID:11495985 | Vector is a broad host range vector (bhr) and is used in the Methylobacterium extorquens AM1. Also can be maintained in the a-proteo-bacteria Agrobacterium tumefaciens, Methylobacterium strains CM4 and DM4, and Rhodobacter sphaeroides, the b-proteobacterium Ralstonia eutropha and the c-proteobacteria Methylococcus capsulatus Bath and Pseudomonas aeruginosa (see linked article). | Backbone Marker:NEB; Backbone Size:6878; Vector Backbone:pUC19; Vector Types:broad host range cloning vector; Bacterial Resistance:Tetracycline | 2026-08-15 01:15:27 | 0 | |||
|
pCM66 Resource Report Resource Website |
RRID:Addgene_45827 | Kanamycin | PMID:11495985 | Vector is a broad host range vector (bhr) and is used in the Methylobacterium extorquens AM1. | Backbone Marker:Lidstrom Lab (Addgene plasmid 45826); Backbone Size:7607; Vector Backbone:pCM62; Vector Types:broad host range cloning vector in bacteria; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:26 | 0 | |||
|
pMSCV-puro-mMCL1 Delta C22 Resource Report Resource Website |
RRID:Addgene_45820 | mMCL-1 Delta C22 | Mus musculus | Ampicillin | PMID:22544066 | Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C-terminal 22 amino acids are deleted from full length mMCL-1 | 2026-08-15 01:15:26 | 0 | |
|
pBEST-OR2-OR1-Pr-UTR1-araC-T500 Resource Report Resource Website |
RRID:Addgene_45786 | araC | Ampicillin | Backbone Marker:Promega; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 0 | ||||
|
pBEST-OR2-OR1-Pr-araC, pBAD-TetR, pBAD-TetO1-deGFP-ssrA Resource Report Resource Website 1+ mentions |
RRID:Addgene_45789 | deGFP | Ampicillin | Backbone Marker:Promega; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | ||||
|
pBEST-pTar-UTR1-TetR-T500 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45780 | Tetracycline repressor | Ampicillin | Backbone Marker:Promega; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | ||||
|
pBabe RFP-DN-FOXO1-HA neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_45813 | FOXO1 | Homo sapiens | Ampicillin | PMID:21873240 | Backbone Size:5729; Vector Backbone:pBabe N-terminal RFP neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | aa1-255 | 2026-08-15 01:15:26 | 1 | |
|
pBabe HA-Runx1-neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_45815 | Runx1 | Mus musculus | Ampicillin | PMID:21873240 | pBabe HA-Runx1 neo was constructed by PCR using a mouse Runx1 template (Open Biosystems) and the following primers: GCGCAGATCTATGTACCCATACGACGTCCCAGACTACGCTGCTTCAGACAGCATTTTTGAGTC (forward), GCGCGAATTCTCAGAAGCATTCACAGTTTCC (reverse). The PCR product was gel purified, digested with BglII and EcoRI, and then ligated into pBabe neo, which had been digested with BamHI and EcoRI and then dephosphorylated. | Backbone Marker:Weinberg Lab (Addgene plasmid 1767); Backbone Size:5300; Vector Backbone:pBabe neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | |
|
pBabe DN-FOXO1-HA neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_45814 | FOXO1 | Homo sapiens | Ampicillin | PMID:21873240 | pBabe DN-FOXO1-HA-neo was constructed by PCR using a pBabe FOXO1 template (Nakamura N, et al. (2000) Mol Cell Biol 20(23):8969-8982) and the following primers: GCGCGGATCCATGGCCGAGGCGCCTCAG (forward), GCGCGTCGACTTAAGCGTAGTCTGGGACGTCGTATGGGTATGCAGCTCTTCTCCTAGGAG (reverse). The PCR product was gel purified, digested with BamHI and SalI, and then ligated into pBabe neo, which had been digested with BamHI and SalI and then dephosphorylated. | Backbone Marker:Weinberg Lab (Addgene plasmid 1767); Backbone Size:5300; Vector Backbone:pBabe neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | aa1-255 | 2026-08-15 01:15:26 | 2 |
|
pMSCV-puro-Delta N67-mMCL1 Resource Report Resource Website |
RRID:Addgene_45819 | Delta N67-mMCL-1 | Mus musculus | Ampicillin | PMID:22544066 | Note that AA68 has been changed from Pro to Met for start codon. | Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N-terminus 67 amino acids deleted from full length mMCL-1 | 2026-08-15 01:15:26 | 0 |
|
pEGFP-Nck1 (SH2 mut) Resource Report Resource Website |
RRID:Addgene_45893 | Nck-1 SH2 mutant | Homo sapiens | Kanamycin | PMID:11959995 | Wild type pEGFP-Nck1 (Addgene plasmid 45903) is described in JBC 26:26633-44 2006 (PMID 16835242). Mutations are described in the article linked to this plasmid (PMID 11959995) and then subcloned into the pEGFP-C1 vector using PCR amplification with primers containing XhoI and EcoRI sites. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | in SH2 domain (R308K) and E302K and Q333H | 2026-08-15 01:15:27 | 0 |
|
pcDNA3-HA-Nck1 Resource Report Resource Website |
RRID:Addgene_45892 | Nck-1 | Homo sapiens | Ampicillin | PMID:11959995 | HA-Nck1 was released from provided HA-Nck1 construct with a BamHI/EcoRI digest, subcloned into HAPCRII and then released with HindIII/EcoRI and ligated into pcDNA3. Insert contains Kozak sequence. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
