Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 94 showing 1861 ~ 1880 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_64794

    This resource has 1+ mentions.

http://www.addgene.org/64794

Species: Homo sapiens
Genetic Insert: Lin28b promoter P3
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19211792

Proper citation: RRID:Addgene_64794 Copy   


  • RRID:Addgene_64790

http://www.addgene.org/64790

Species: Homo sapiens
Genetic Insert: miR-34a promoter P6
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599

Proper citation: RRID:Addgene_64790 Copy   


  • RRID:Addgene_64967

    This resource has 1+ mentions.

http://www.addgene.org/64967

Genetic Insert: tnsABCD
Vector Backbone Description: Vector Backbone:unknown; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15908923

Proper citation: RRID:Addgene_64967 Copy   


  • RRID:Addgene_64973

http://www.addgene.org/64973

Species: Staphylococcus aureus ATCC 10832
Genetic Insert: sortase A
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22729808

Proper citation: RRID:Addgene_64973 Copy   


http://www.addgene.org/64972

Species: Homo sapiens
Genetic Insert: syndecan 2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24662262
Comments: Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (FAAF).

Proper citation: RRID:Addgene_64972 Copy   


  • RRID:Addgene_64909

http://www.addgene.org/64909

Vector Backbone Description: Backbone Size:3000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology, E. coli; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25982507

Proper citation: RRID:Addgene_64909 Copy   


  • RRID:Addgene_64981

http://www.addgene.org/64981

Species: Staphylococcus aureus ATCC 10832
Genetic Insert: sortase A
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22729808

Proper citation: RRID:Addgene_64981 Copy   


  • RRID:Addgene_64980

http://www.addgene.org/64980

Species: Staphylococcus aureus ATCC 10832
Genetic Insert: sortase A
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22729808

Proper citation: RRID:Addgene_64980 Copy   


  • RRID:Addgene_64913

http://www.addgene.org/64913

Species: Synthetic
Genetic Insert: pnGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5968; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24059533
Comments: Please cite Z. Chen, W. Ren, Q.E. Wright and H-w. Ai*, J. Am. Chem. Soc., 2013, 135: 14940-14943.

Proper citation: RRID:Addgene_64913 Copy   


  • RRID:Addgene_64912

http://www.addgene.org/64912

Species: Synthetic
Genetic Insert: hsGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5968; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25141269
Comments: Please cite Z. Chen and H-w. Ai*, Biochemistry, 2014, 53: 5966-5974; and S. Chen, Z. Chen, W. Ren and H-w. Ai*, J. Am. Chem. Soc., 2012, 134: 9589-9592. Please note that you will also need a pMAH plasmid for mammalian expression. pMAH-POLY (Z. Chen, W. Ren, Q.E. Wright and H-w. Ai*, J. Am. Chem. Soc., 2013, 135: 14940-14943.) is also deposited to Addgene, which can be used to replace pMAH-AzF for mammalian applications.

Proper citation: RRID:Addgene_64912 Copy   


  • RRID:Addgene_64911

http://www.addgene.org/64911

Species: Synthetic
Genetic Insert: hsGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3954; Vector Backbone:pBAD/HisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25141269
Comments: Please cite: Z. Chen and H-w. Ai*, Biochemistry, 2014, 53: 5966-5974; and S. Chen, Z. Chen, W. Ren and H-w. Ai*, J. Am. Chem. Soc., 2012, 134: 9589-9592. For E. coli expression, you will also need pEVOL-pAzF (Addgene # 31186): https://www.addgene.org/31186/

Proper citation: RRID:Addgene_64911 Copy   


http://www.addgene.org/64999

Species: Homo sapiens
Genetic Insert: Glutaredoxin-1
Vector Backbone Description: Vector Backbone:pCaSpeR4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22100409
Comments: Sequence discrepancies found during QC should not affect function

Proper citation: RRID:Addgene_64999 Copy   


  • RRID:Addgene_64992

    This resource has 10+ mentions.

http://www.addgene.org/64992

Species: Saccharomyces cerevisiae
Genetic Insert: Orp1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19755417

Proper citation: RRID:Addgene_64992 Copy   


  • RRID:Addgene_64991

    This resource has 1+ mentions.

http://www.addgene.org/64991

Species: Saccharomyces cerevisiae
Genetic Insert: Orp1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19755417

Proper citation: RRID:Addgene_64991 Copy   


  • RRID:Addgene_64990

    This resource has 1+ mentions.

http://www.addgene.org/64990

Species: Homo sapiens
Genetic Insert: Glutaredoxin-1
Vector Backbone Description: Vector Backbone:pEIGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18469822
Comments: Sequence discrepancies found during QC should not affect function

Proper citation: RRID:Addgene_64990 Copy   


  • RRID:Addgene_64887

    This resource has 1+ mentions.

http://www.addgene.org/64887

Species: Rhodopseudomonas palustris
Genetic Insert: iRFP
Vector Backbone Description: Backbone Marker:Cell Biolabs; Vector Backbone:pAAV-CMV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25391913

Proper citation: RRID:Addgene_64887 Copy   


  • RRID:Addgene_64888

    This resource has 1+ mentions.

http://www.addgene.org/64888

Species: Mus musculus
Genetic Insert: MITF
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBABE-puro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16648630
Comments: This plasmid contains the alternatively spliced MITF (-) isoform.

Proper citation: RRID:Addgene_64888 Copy   


  • RRID:Addgene_64928

    This resource has 1+ mentions.

http://www.addgene.org/64928

Species: Homo sapiens
Genetic Insert: TORCAR(T/A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25772363

Proper citation: RRID:Addgene_64928 Copy   


  • RRID:Addgene_64927

    This resource has 10+ mentions.

http://www.addgene.org/64927

Species: Homo sapiens
Genetic Insert: TORCAR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25772363

Proper citation: RRID:Addgene_64927 Copy   


  • RRID:Addgene_64885

http://www.addgene.org/64885

Species: Homo sapiens
Genetic Insert: POLN
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDEST17; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20144948

Proper citation: RRID:Addgene_64885 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X