Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: Rsc202375 genomic upstream region
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:4190; Vector Backbone:LI+BpiI; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29077245
Proper citation: RRID:Addgene_104526 Copy
Species: Other
Genetic Insert: lacZ
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:2974; Vector Backbone:CloneJET; Vector Types:Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29077245
Proper citation: RRID:Addgene_104528 Copy
Species: Other
Genetic Insert: Kanamycin resistance gene
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:4190; Vector Backbone:LI+BpiI; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29077245
Proper citation: RRID:Addgene_104523 Copy
Species: Other
Genetic Insert: Apramycin resistance gene
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:2974; Vector Backbone:CloneJET; Vector Types:Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29077245
Proper citation: RRID:Addgene_104522 Copy
Species: Other
Genetic Insert: Chloramphenicol resistance gene
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29077245
Proper citation: RRID:Addgene_104525 Copy
Species: Other
Genetic Insert: Gala7 promoter
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29077245
Proper citation: RRID:Addgene_104516 Copy
Species: Other
Genetic Insert: Gateway cassette
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Chloramphenicol and Gentamicin
Defining Citation: PMID:29077245
Proper citation: RRID:Addgene_104518 Copy
Species: Other
Genetic Insert: hrpB promoter
Vector Backbone Description: Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29077245
Proper citation: RRID:Addgene_104514 Copy
Species: Other
Genetic Insert: Fen
Vector Backbone Description: Backbone Marker:self-made; Backbone Size:2251; Vector Backbone:pICH41308; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29194629
Comments: release insert with BsaI and clone to Level 1 cloning vector
Proper citation: RRID:Addgene_104718 Copy
Species: Other
Genetic Insert: Pto
Vector Backbone Description: Backbone Marker:self-made; Backbone Size:2251; Vector Backbone:pICH41308; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29194629
Comments: release insert with BsaI and clone to Level 1 cloning vector
Proper citation: RRID:Addgene_104719 Copy
Species: Other
Genetic Insert: PhyB NT GBD
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301067
Comments: Construct contains amino acids 1-621 PhyB [NCBI NP_001325249.1].
Proper citation: RRID:Addgene_104853 Copy
Species: Other
Genetic Insert: PIF3-GBD
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301067
Proper citation: RRID:Addgene_104854 Copy
Species: Other
Genetic Insert: Glyma17g11235
Vector Backbone Description: Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Comments: 112-151:1.1. Alternative name of plasmid: pSG218UG
Proper citation: RRID:Addgene_104823 Copy
Species: Other
Genetic Insert: Glyma.12g075700, Glyma.11g145900
Vector Backbone Description: Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29087011
Comments: 112-277:2.1. Alternative name of plasmid: pSG218GG. Please note that this plasmid contains two (ttagctggaatcatgtttac) gRNA cassettes. The plasmid still functions as described in the publication.
Proper citation: RRID:Addgene_104825 Copy
Species: Other
Genetic Insert: Medtr2g044580
Vector Backbone Description: Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28057894
Comments: 112-15:1.1. Alternative name of plasmid: pSG218GG
Proper citation: RRID:Addgene_104787 Copy
Species: Other
Genetic Insert: Medtr2g020630
Vector Backbone Description: Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28057894
Comments: 112-142:6.1. Alternative name of plasmid: pSG218GG
Proper citation: RRID:Addgene_104793 Copy
Species: Other
Genetic Insert: Medtr2g101090
Vector Backbone Description: Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28057894
Comments: 112-40:6.1. Alternative name of plasmid: pSG218UG
Proper citation: RRID:Addgene_104806 Copy
Species: Other
Genetic Insert: Medtr4g020620
Vector Backbone Description: Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28057894
Comments: 112-135:1.1 & 1.2. Alternative name of plasmid: pSG218GG
Proper citation: RRID:Addgene_104801 Copy
Species: Other
Genetic Insert: Glyma.04g057400
Vector Backbone Description: Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29087011
Comments: 111-212:2.1. Alternative name of plasmid: pSG218UG
Proper citation: RRID:Addgene_104817 Copy
Species: Other
Genetic Insert: Glyma.04g057400
Vector Backbone Description: Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29087011
Comments: 111-212:3.1. Alternative name of plasmid: pSG218RG
Proper citation: RRID:Addgene_104818 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
