Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Schmidtea mediterranea
Genetic Insert: Smed-dmd-3, 3’ RACE product
Vector Backbone Description: Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23652002
Proper citation: RRID:Addgene_44691 Copy
Species: Mus musculus
Genetic Insert: beta Klotho
Vector Backbone Description: Backbone Size:4986; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:26881702
Proper citation: RRID:Addgene_45531 Copy
Vector Backbone Description: Backbone Marker:Lidstrom Lab (PMID 8021187); Backbone Size:6000; Vector Backbone:pAYC61; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:12449384
Comments: This allelic exchange vector is used with Cre expression vectors (Addgene plasmids 45863 or 45864) to generate unmarked mutants in a broad bacterial host range.
The full plasmid sequence is approximate and there may be small discrepancies present.
Proper citation: RRID:Addgene_46012 Copy
Species: Danio rerio
Genetic Insert: tia1l-sgRNA target site-hsp70-EGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCR2.1-TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:36050398
Comments: The tia1l sgRNA was designed and published by Hwang et al., 2013, Nature Biotechnology: https://pubmed.ncbi.nlm.nih.gov/23360964/.
The strategy is based on a method described by Lackner et al. 2015, Nature Communications: https://pubmed.ncbi.nlm.nih.gov/26674669/.
Proper citation: RRID:Addgene_177837 Copy
Species: E. coli
Genetic Insert: AraC/PBAD
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:4559; Vector Backbone:pSAM_Ec; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28614382
Comments: Mariner himar1C9 transposase driven by an arabinose promoter on an R6K gamma suicide plasmid. The transposon allows identification of fitness factors by Illumina sequencing. This transposon will randomly insert a kanamycin resistance cassette into genomic TA sites. Ampicillin resistance is contained on the plasmid backbone.
For further background, see:
Goodman, Andrew L., Meng Wu, and Jeffrey I. Gordon. “Identifying Microbial Fitness Determinants by Insertion Sequencing (INSeq) Using Genome-Wide Transposon Mutant Libraries.” Nature Protocols 6.12 (2011): 1969–1980. PMC. Web. 11 Apr. 2017.
Wiles, Travis J. et al. “Combining Quantitative Genetic Footprinting and Trait Enrichment Analysis to Identify Fitness Determinants of a Bacterial Pathogen.” Ed. Danielle A. Garsin. PLoS Genetics 9.8 (2013): e1003716. PMC. Web. 11 Apr. 2017.
Proper citation: RRID:Addgene_91569 Copy
Species: Other
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92081 Copy
Species: Other
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92085 Copy
Species: Other
Genetic Insert: 4xFlag
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92086 Copy
Species: Other
Genetic Insert: 6xHA
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92083 Copy
Species: Other
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Comments: Addgene's sequencing results found K128R and Q193P mutations in mCherry. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_92084 Copy
Species: Other
Genetic Insert: 4xFlag
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92082 Copy
Species: Synthetic
Genetic Insert: Actb MMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agtccgcctagaagcacttg
Proper citation: RRID:Addgene_97315 Copy
Species: Synthetic
Genetic Insert: Actb NHEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agtccgcctagaagcacttg
Proper citation: RRID:Addgene_97316 Copy
Species: Synthetic
Genetic Insert: Cdx2 HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agaccacgggaggggtcact
Proper citation: RRID:Addgene_97319 Copy
Species: Synthetic
Genetic Insert: Nanog HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: cgtaagtctcatatttcacc
Proper citation: RRID:Addgene_97321 Copy
Species: Synthetic
Genetic Insert: Sox2 HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: tgcccctgtcgcacatgtga
Proper citation: RRID:Addgene_97322 Copy
Species: Homo sapiens
Genetic Insert: hsa-let-7b-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103148 Copy
Species: Synthetic
Genetic Insert: gRNA PCR template
Vector Backbone Description: Backbone Marker:TransGen Biotech; Vector Backbone:pEASY-blunt; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29703785
Comments: These plasmids are used for a cloning-free method of CRISPR/Cas9-mediated genome editing in fission yeast. This method takes advantage of gap repair in fission yeast cells to assemble two linear DNA fragments, a gapped Cas9-encoding plasmid and a PCR-amplified gRNA insert, into a circular plasmid. To reduce non-specific gap repair background, we adopt a split-marker strategy. pDB4280 and pDB4282 serve as the source of the gapped plasmid and the PCR template for gRNA insert amplification, respectively, in the split-ura4 system. pDB4281 and pDB4283 serve the same purposes for the split-bsdMX system. pDB4279 is a transformation control for the split-bsdMX system.
Proper citation: RRID:Addgene_98701 Copy
Species: Synthetic
Genetic Insert: gRNA PCR template
Vector Backbone Description: Backbone Marker:TransGen Biotech; Vector Backbone:pEASY-blunt; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29703785
Comments: These plasmids are used for a cloning-free method of CRISPR/Cas9-mediated genome editing in fission yeast. This method takes advantage of gap repair in fission yeast cells to assemble two linear DNA fragments, a gapped Cas9-encoding plasmid and a PCR-amplified gRNA insert, into a circular plasmid. To reduce non-specific gap repair background, we adopt a split-marker strategy. pDB4280 and pDB4282 serve as the source of the gapped plasmid and the PCR template for gRNA insert amplification, respectively, in the split-ura4 system. pDB4281 and pDB4283 serve the same purposes for the split-bsdMX system. pDB4279 is a transformation control for the split-bsdMX system.
Proper citation: RRID:Addgene_98702 Copy
Species: Schmidtea mediterranea
Genetic Insert: mblk in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-CGTGCTCGTGAGAATTGTTG, R-AGTACGCAGCAGAGGCAAGT
Proper citation: RRID:Addgene_99091 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
