Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Aequorea victoria
Genetic Insert: synthetic sfYFP (codon usage adapted to P.putida KT2440)
Vector Backbone Description: Backbone Marker:Dammeyer et al. 2013; Vector Backbone:pTDpelB-CTwinStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates.
The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long
Proper citation: RRID:Addgene_45944 Copy
Genetic Insert: U6-BbsI-chiRNA
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:2958; Vector Backbone:pBS-SK(+); Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23709638
Comments: For more information on FlyCRISPR plasmids please refer to: https://www.addgene.org/browse/article/6834/.
Plasmid 51019: pDsRed-attP (www.addgene.org/51019) can be for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site.
Please note the F1 ori is in the (+) orientation, rather than the (-) orientation shown in the assembled full sequence.
Proper citation: RRID:Addgene_45946 Copy
Vector Backbone Description: Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates.
The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long
Proper citation: RRID:Addgene_45940 Copy
Species: Homo sapiens
Genetic Insert: Eps-15 homology domain-containing protein2
Vector Backbone Description: Backbone Marker:Clontech/ custom-made; Backbone Size:4745; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22505029
Proper citation: RRID:Addgene_45934 Copy
Species: Homo sapiens
Genetic Insert: Eps-15 homology domain-containing protein2
Vector Backbone Description: Backbone Marker:Clontech/ custom-made; Backbone Size:4736; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22505029
Proper citation: RRID:Addgene_45933 Copy
Vector Backbone Description: Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates.
The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long
Proper citation: RRID:Addgene_45936 Copy
Species: Homo sapiens
Genetic Insert: Eps-15 homology domain-containing protein2
Vector Backbone Description: Backbone Marker:Clontech/ custom-made; Backbone Size:4736; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22505029
Proper citation: RRID:Addgene_45935 Copy
Vector Backbone Description: Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates.
The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long
Proper citation: RRID:Addgene_45937 Copy
Vector Backbone Description: Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates.
The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long
Proper citation: RRID:Addgene_45939 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5336; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46059 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4734; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46058 Copy
Species: Rattus norvegicus
Genetic Insert: Jag1
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pT3-EF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23419361
Comments: This plasmid is in the pT3-EF1a vector which contains loxP sites flanking the inverted repeats of SB (sleeping beauty) sequence. Therefore this plasmid cannot not used with Cre for in vivo studies.
Proper citation: RRID:Addgene_46051 Copy
Species: Synthetic
Genetic Insert: klp-12 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GATCCACAAGTTACAATTGG
Proper citation: RRID:Addgene_46170 Copy
Species: Homo sapiens
Genetic Insert: Yes-kinase associated protein
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23419361
Proper citation: RRID:Addgene_46050 Copy
Species: Gallus gallus
Genetic Insert: Vcl
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15195105
Proper citation: RRID:Addgene_46171 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5205; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46055 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4880; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46056 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5468; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46053 Copy
Species: Mus musculus
Genetic Insert: Notch1 (C-term)
Vector Backbone Description: Backbone Marker:Invitrogen ; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22797301
Proper citation: RRID:Addgene_46048 Copy
Species: Synthetic
Genetic Insert: unc-119 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GAATTTTCTGAAATTAAAGA
Proper citation: RRID:Addgene_46169 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.