Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pTDpelB-C_sfYFPTwinStrep
 
Resource Report
Resource Website
RRID:Addgene_45944 synthetic sfYFP (codon usage adapted to P.putida KT2440) Aequorea victoria Streptomycin PMID:23687945 This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long Backbone Marker:Dammeyer et al. 2013; Vector Backbone:pTDpelB-CTwinStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:15:27 0
pU6-BbsI-chiRNA
 
Resource Report
Resource Website
100+ mentions
RRID:Addgene_45946 U6-BbsI-chiRNA Ampicillin PMID:23709638 For more information on FlyCRISPR plasmids please refer to: https://www.addgene.org/browse/article/6834/. Plasmid 51019: pDsRed-attP (www.addgene.org/51019) can be for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site. Please note the F1 ori is in the (+) orientation, rather than the (-) orientation shown in the assembled full sequence. Backbone Marker:Agilent; Backbone Size:2958; Vector Backbone:pBS-SK(+); Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:27 191
pTDpelB-NTwinStrep
 
Resource Report
Resource Website
RRID:Addgene_45940 Streptomycin PMID:23687945 This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:15:27 0
EHD2-T72A-mEGFP
 
Resource Report
Resource Website
RRID:Addgene_45934 Eps-15 homology domain-containing protein2 Homo sapiens Kanamycin PMID:22505029 Backbone Marker:Clontech/ custom-made; Backbone Size:4745; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin T 72 changed to A (T72A) 2026-08-15 01:15:27 0
EHD2-mCherry
 
Resource Report
Resource Website
RRID:Addgene_45933 Eps-15 homology domain-containing protein2 Homo sapiens Kanamycin PMID:22505029 Backbone Marker:Clontech/ custom-made; Backbone Size:4736; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:27 0
pTD-NStrepHis
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45936 Streptomycin PMID:23687945 This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:15:27 1
EHD2-T72A-mCherry
 
Resource Report
Resource Website
RRID:Addgene_45935 Eps-15 homology domain-containing protein2 Homo sapiens Kanamycin PMID:22505029 Backbone Marker:Clontech/ custom-made; Backbone Size:4736; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin T 72 changed to A (T72A) 2026-08-15 01:15:27 0
pTD-NTwinStrep_Sm
 
Resource Report
Resource Website
RRID:Addgene_45937 Streptomycin PMID:23687945 This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:15:27 0
pTD-CTwinStrep
 
Resource Report
Resource Website
RRID:Addgene_45939 Streptomycin PMID:23687945 This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:15:27 0
pXP741
 
Resource Report
Resource Website
RRID:Addgene_46059 Ampicillin PMID:23166051 Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function. Backbone Marker:Invitrogen; Backbone Size:5336; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:28 0
pXP732
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46058 Ampicillin PMID:23166051 Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function. Backbone Marker:Invitrogen; Backbone Size:4734; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:28 2
pT3-EFa1-HA-Jag1
 
Resource Report
Resource Website
RRID:Addgene_46051 Jag1 Rattus norvegicus Ampicillin PMID:23419361 This plasmid is in the pT3-EF1a vector which contains loxP sites flanking the inverted repeats of SB (sleeping beauty) sequence. Therefore this plasmid cannot not used with Cre for in vivo studies. Backbone Size:7000; Vector Backbone:pT3-EF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:28 0
PU6::klp-12_sgRNA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46170 klp-12 targeting sgRNA Synthetic Ampicillin PMID:23817069 gRNA target sequence GATCCACAAGTTACAATTGG Backbone Size:2641; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 7
pENTR1A-Yap S127A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46050 Yes-kinase associated protein Homo sapiens Kanamycin PMID:23419361 Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin S127A 2026-08-15 01:15:28 1
pET15b/GgVcl 1-1066 (full length)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46171 Vcl Gallus gallus Ampicillin PMID:15195105 Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pXP721
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46055 Ampicillin PMID:23166051 Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function. Backbone Marker:Invitrogen; Backbone Size:5205; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:28 1
pXP722
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46056 Ampicillin PMID:23166051 Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function. Backbone Marker:Invitrogen; Backbone Size:4880; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:28 1
pXP711
 
Resource Report
Resource Website
RRID:Addgene_46053 Ampicillin PMID:23166051 Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function. Backbone Marker:Invitrogen; Backbone Size:5468; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:28 0
pENTR-NICD1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46048 Notch1 (C-term) Mus musculus Kanamycin PMID:22797301 Backbone Marker:Invitrogen ; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin Cytoplasmic domain initiating at amino acid 1753 2026-08-15 01:15:28 4
PU6::unc-119_sgRNA
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46169 unc-119 targeting sgRNA Synthetic Ampicillin PMID:23817069 gRNA target sequence GAATTTTCTGAAATTAAAGA Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 29

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.