Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pTDpelB-C_sfYFPTwinStrep Resource Report Resource Website |
RRID:Addgene_45944 | synthetic sfYFP (codon usage adapted to P.putida KT2440) | Aequorea victoria | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:Dammeyer et al. 2013; Vector Backbone:pTDpelB-CTwinStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 0 | |
|
pU6-BbsI-chiRNA Resource Report Resource Website 100+ mentions |
RRID:Addgene_45946 | U6-BbsI-chiRNA | Ampicillin | PMID:23709638 | For more information on FlyCRISPR plasmids please refer to: https://www.addgene.org/browse/article/6834/. Plasmid 51019: pDsRed-attP (www.addgene.org/51019) can be for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site. Please note the F1 ori is in the (+) orientation, rather than the (-) orientation shown in the assembled full sequence. | Backbone Marker:Agilent; Backbone Size:2958; Vector Backbone:pBS-SK(+); Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 191 | ||
|
pTDpelB-NTwinStrep Resource Report Resource Website |
RRID:Addgene_45940 | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 0 | |||
|
EHD2-T72A-mEGFP Resource Report Resource Website |
RRID:Addgene_45934 | Eps-15 homology domain-containing protein2 | Homo sapiens | Kanamycin | PMID:22505029 | Backbone Marker:Clontech/ custom-made; Backbone Size:4745; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | T 72 changed to A (T72A) | 2026-08-15 01:15:27 | 0 | |
|
EHD2-mCherry Resource Report Resource Website |
RRID:Addgene_45933 | Eps-15 homology domain-containing protein2 | Homo sapiens | Kanamycin | PMID:22505029 | Backbone Marker:Clontech/ custom-made; Backbone Size:4736; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:27 | 0 | ||
|
pTD-NStrepHis Resource Report Resource Website 1+ mentions |
RRID:Addgene_45936 | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 1 | |||
|
EHD2-T72A-mCherry Resource Report Resource Website |
RRID:Addgene_45935 | Eps-15 homology domain-containing protein2 | Homo sapiens | Kanamycin | PMID:22505029 | Backbone Marker:Clontech/ custom-made; Backbone Size:4736; Vector Backbone:pmEGFP-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | T 72 changed to A (T72A) | 2026-08-15 01:15:27 | 0 | |
|
pTD-NTwinStrep_Sm Resource Report Resource Website |
RRID:Addgene_45937 | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 0 | |||
|
pTD-CTwinStrep Resource Report Resource Website |
RRID:Addgene_45939 | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 0 | |||
|
pXP741 Resource Report Resource Website |
RRID:Addgene_46059 | Ampicillin | PMID:23166051 | Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function. | Backbone Marker:Invitrogen; Backbone Size:5336; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:28 | 0 | |||
|
pXP732 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46058 | Ampicillin | PMID:23166051 | Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function. | Backbone Marker:Invitrogen; Backbone Size:4734; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:28 | 2 | |||
|
pT3-EFa1-HA-Jag1 Resource Report Resource Website |
RRID:Addgene_46051 | Jag1 | Rattus norvegicus | Ampicillin | PMID:23419361 | This plasmid is in the pT3-EF1a vector which contains loxP sites flanking the inverted repeats of SB (sleeping beauty) sequence. Therefore this plasmid cannot not used with Cre for in vivo studies. | Backbone Size:7000; Vector Backbone:pT3-EF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:28 | 0 | |
|
PU6::klp-12_sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_46170 | klp-12 targeting sgRNA | Synthetic | Ampicillin | PMID:23817069 | gRNA target sequence GATCCACAAGTTACAATTGG | Backbone Size:2641; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 7 | |
|
pENTR1A-Yap S127A Resource Report Resource Website 1+ mentions |
RRID:Addgene_46050 | Yes-kinase associated protein | Homo sapiens | Kanamycin | PMID:23419361 | Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | S127A | 2026-08-15 01:15:28 | 1 | |
|
pET15b/GgVcl 1-1066 (full length) Resource Report Resource Website 1+ mentions |
RRID:Addgene_46171 | Vcl | Gallus gallus | Ampicillin | PMID:15195105 | Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 1 | ||
|
pXP721 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46055 | Ampicillin | PMID:23166051 | Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function. | Backbone Marker:Invitrogen; Backbone Size:5205; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:28 | 1 | |||
|
pXP722 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46056 | Ampicillin | PMID:23166051 | Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function. | Backbone Marker:Invitrogen; Backbone Size:4880; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:28 | 1 | |||
|
pXP711 Resource Report Resource Website |
RRID:Addgene_46053 | Ampicillin | PMID:23166051 | Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function. | Backbone Marker:Invitrogen; Backbone Size:5468; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:28 | 0 | |||
|
pENTR-NICD1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46048 | Notch1 (C-term) | Mus musculus | Kanamycin | PMID:22797301 | Backbone Marker:Invitrogen ; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Cytoplasmic domain initiating at amino acid 1753 | 2026-08-15 01:15:28 | 4 | |
|
PU6::unc-119_sgRNA Resource Report Resource Website 10+ mentions |
RRID:Addgene_46169 | unc-119 targeting sgRNA | Synthetic | Ampicillin | PMID:23817069 | gRNA target sequence GAATTTTCTGAAATTAAAGA | Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 29 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
