Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 97 showing 1921 ~ 1940 out of 2,177 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_47763

http://www.addgene.org/47763

Species: Rattus norvegicus
Genetic Insert: PMCA3b
Vector Backbone Description: Backbone Marker: Adamo, H.P. et al. (1992) Biochem. J. 285, 791-797; Vector Backbone:pMM2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9346883
Comments: The correction of a C-terminal read through is described in Goellner, et al. 2003 (PMID 12763866).

Proper citation: RRID:Addgene_47763 Copy   


  • RRID:Addgene_184504

http://www.addgene.org/184504

Species: Rattus norvegicus
Genetic Insert: Synaptotagmin 3
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22398727
Comments: The first codon of the Synpatotagmin has been removed

Proper citation: RRID:Addgene_184504 Copy   


http://www.addgene.org/198848

Species: Rattus norvegicus
Genetic Insert: CYTB-W77-L15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198848 Copy   


http://www.addgene.org/198846

Species: Rattus norvegicus
Genetic Insert: COX3-W16-L17 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198846 Copy   


http://www.addgene.org/198858

Species: Rattus norvegicus
Genetic Insert: ND5-W68-L15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198858 Copy   


http://www.addgene.org/198854

Species: Rattus norvegicus
Genetic Insert: ND3-Q26-L18 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198854 Copy   


http://www.addgene.org/198852

Species: Rattus norvegicus
Genetic Insert: ND2-W30-L16 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198852 Copy   


http://www.addgene.org/198850

Species: Rattus norvegicus
Genetic Insert: ND1-W86-L14 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198850 Copy   


  • RRID:Addgene_199750

http://www.addgene.org/199750

Species: Rattus norvegicus
Genetic Insert: Lamp1
Vector Backbone Description: Vector Backbone:pLJM1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36007018

Proper citation: RRID:Addgene_199750 Copy   


  • RRID:Addgene_199611

http://www.addgene.org/199611

Species: Rattus norvegicus
Genetic Insert: Gephyrin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFPC2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36314779
Comments: Gephyrin C4a cassette encodes ARLPSCSSTYSVSE after K288 (expressed in neurons and promotes oligomerization of gephyrin molecules for synapse scaffolding. Inhibitory synapse distribution for C4a and P1 variant of gephyrin currently unknown)

Proper citation: RRID:Addgene_199611 Copy   


http://www.addgene.org/198861

Species: Rattus norvegicus
Genetic Insert: ND6-W82-R15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198861 Copy   


http://www.addgene.org/199608

Species: Rattus norvegicus
Genetic Insert: Gephyrin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFPC2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23408424

Proper citation: RRID:Addgene_199608 Copy   


http://www.addgene.org/198847

Species: Rattus norvegicus
Genetic Insert: COX3-W16-R15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198847 Copy   


http://www.addgene.org/198843

Species: Rattus norvegicus
Genetic Insert: COX1-W25-R18 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198843 Copy   


http://www.addgene.org/198859

Species: Rattus norvegicus
Genetic Insert: ND5-W68-R15 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198859 Copy   


http://www.addgene.org/198855

Species: Rattus norvegicus
Genetic Insert: ND3-Q26-R19 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198855 Copy   


http://www.addgene.org/198853

Species: Rattus norvegicus
Genetic Insert: ND2-W30-R18 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

Proper citation: RRID:Addgene_198853 Copy   


  • RRID:Addgene_197305

http://www.addgene.org/197305

Species: Rattus norvegicus
Genetic Insert: mGluR5a
Vector Backbone Description: Vector Backbone:pCI-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-mGluR1/5 (Group I) glutamate receptor [N75/33R].

Proper citation: RRID:Addgene_197305 Copy   


  • RRID:Addgene_184502

http://www.addgene.org/184502

Species: Rattus norvegicus
Genetic Insert: Synaptotagmin 1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The first codon of the Synpatotagmin has been removed.

Proper citation: RRID:Addgene_184502 Copy   


  • RRID:Addgene_184514

http://www.addgene.org/184514

Species: Rattus norvegicus
Genetic Insert: Synaptotagmin 17
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22398727
Comments: The first codon of the Synpatotagmin has been removed

Proper citation: RRID:Addgene_184514 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X