Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: hsa-miR-766-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103732 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-887-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103746 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-885-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103744 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-708-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103724 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-7-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103723 Copy
Species: Synthetic
Genetic Insert: Rpl31 C-terminus with FLAG-TEV-AviTag and flanking homology arms
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-4Blunt-TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:40048539
Proper citation: RRID:Addgene_235608 Copy
Genetic Insert: None
Vector Backbone Description: Vector Backbone:R6K origin; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:40148565
Comments: Please visit https://doi.org/10.1101/2024.05.21.595064 for bioRxiv preprint.
Proper citation: RRID:Addgene_236211 Copy
Species: Homo sapiens
Genetic Insert: SOX17 Exon1 gRNA1
Vector Backbone Description: Backbone Size:3979; Vector Backbone:pGuide-U6-gRNA; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Proper citation: RRID:Addgene_131046 Copy
Species: Danio rerio
Genetic Insert: mogat3a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39510175
Proper citation: RRID:Addgene_232135 Copy
Species: Danio rerio
Genetic Insert: mogat2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39510175
Proper citation: RRID:Addgene_232139 Copy
Species: Danio rerio
Genetic Insert: dgat1b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39510175
Proper citation: RRID:Addgene_232138 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: phiC31 attB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3805; Vector Backbone:pCR2.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:10801973
Proper citation: RRID:Addgene_18937 Copy
Species: Synthetic
Genetic Insert: Genomic cassette
Vector Backbone Description: Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24847673
Proper citation: RRID:Addgene_58306 Copy
Species: Synthetic
Genetic Insert: Genomic cassette
Vector Backbone Description: Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24847673
Comments: Please note that Addgene's NGS found a 1209bp transposase insertion between the RepA and Epsilon Antitoxin sequence. The effect of this insertion is unknown. If you are interested in the version without the insertion, please contact the depositing lab (Tom Ellis lab).
Proper citation: RRID:Addgene_58308 Copy
Species: maize (corn)
Genetic Insert: zmU3 promoter - gRNA
Vector Backbone Description: Backbone Marker:Transgen; Backbone Size:3929; Vector Backbone:pEasy-blunt; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24576457
Proper citation: RRID:Addgene_53061 Copy
Vector Backbone Description: Backbone Marker:Mermelstein et al. 1992; Backbone Size:4500; Vector Backbone:pIMP1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:14766568
Comments: For more information about this plasmid, see the associated publication (PMID: 14766568), as well as the publication describing its original construction: Mai, Lorenz, and Wiegel, Transformation of Thermoanaerobacterium sp. strain JW/SL-YS485 with plasmid pIKM1 conferring kanamycin resistance. FEMS Microbiol Lett. 1997 DOI: 10.1111/j.1574-6968.1997.tb10283.x ( http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6968.1997.tb10283.x/abstract )
Proper citation: RRID:Addgene_51054 Copy
Genetic Insert: GFP4m
Vector Backbone Description: Vector Backbone:p2attNG; Vector Types:Mammalian Expression, Human Targeting; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24304893
Proper citation: RRID:Addgene_51546 Copy
Species: Synthetic
Genetic Insert: mCherryS131C
Vector Backbone Description: Backbone Marker:QIAGEN; Backbone Size:3439; Vector Backbone:pQE-9; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:21696135
Comments: This plasmid must be grown under Ampicillin (100ug/ml) and Kanamycin (50ug/ml) selection in order to retain both the mCherryS131C plasmid and the pREP4 helper plasmid.
Please note that verifying this plasmid by sequencing or digest is challenging due to the presence of the helper plasmid, as multiple bands or mispriming is likely to occur. See Addgene's sequencing results for recommended primers.
The S131C mutation in this plasmid is S136C, when compared to the starting Met of wild-type mCherry.
Proper citation: RRID:Addgene_48732 Copy
Species: Schmidtea mediterranea
Genetic Insert: lecg
Vector Backbone Description: Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:35294875
Comments: dsRNA can be generated by in vitro transcription with T7 RNA polymerase and single-stranded probes can be generated with SP6 or T3 RNA polymerases
Proper citation: RRID:Addgene_239180 Copy
Species: Culexarchaeum yellowstonense LCB-24-027
Genetic Insert: 16S rRNA
Vector Backbone Description: Vector Backbone:pcr2.1-oriT; Vector Types:Other; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:41247030
Proper citation: RRID:Addgene_245842 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
