Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Authority:addgene (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

177,820 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
Peft-3::cas9-SV40_NLS::tbb-2 3'UTR
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46168 codon optimized Cas9_SV40 NLS with intron Synthetic Ampicillin PMID:23817069 Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin intron inserted at position 3113-3163, and SV40 NLS inserted from position 5192-5227 2026-08-15 01:15:29 47
pQUASp
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46162 Ampicillin PMID:27694947 Backbone Size:9909; Vector Backbone:pUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 5
pQUASp-mCD8mCherry
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46164 mCD8mCherry Mus musculus Ampicillin Backbone Size:9929; Vector Backbone:pQUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pJC-TALE-hairy
 
Resource Report
Resource Website
RRID:Addgene_46145 Ampicillin PMID:23817068 Backbone Marker:Gerry Rubin; Backbone Size:8151; Vector Backbone:pJFRC-7; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pFT1.2
 
Resource Report
Resource Website
RRID:Addgene_46140 mCherry Ampicillin PMID:22908272 mCherry is in the "+2" reading frame starting from the exon. This is a Tol2-based FlExTrap vector. It consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon. Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pT2-eab2-[GTR]
 
Resource Report
Resource Website
RRID:Addgene_46144 EGFP/mCherry Ampicillin PMID:19415631 This plasmid can be used to make a transgene that expresses EGFP but can be switched to express mCherry if inverted. This reporter is controlled by a 2.3 kb regulatory sequence consisting of 0.2 kb Xenopus EF1alpha enhancer and 2.1 kb zebrafish beta-actin 2 sequence including the 1.5 kb enhancer/promoter sequence, the 1st exon (86 bp) and part of the 1st intron (490 bp). To generate a complete intron, the splice acceptor from the rabbit beta-globin gene was placed upstream of the EGFP reporter and a synthetic splice acceptor was placed upstream of the mCherry reporter. The synthetic splice acceptor contains the zebrafish consensus sequence along with intronic and exonic splice enhancers. There are some discrepancies between Addgene's and the depositor's sequence--these do not affect plasmid function. Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, Tol2 zebrafish transgenic expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pPTQF#7-hsp70
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46136 QF#7 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:5176; Vector Backbone:pPTGAL4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pQUAST-GAL80
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46137 GAL80 Saccharomyces cerevisiae Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:8938; Vector Backbone:pQUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pFT1.0
 
Resource Report
Resource Website
RRID:Addgene_46138 mCherry Ampicillin PMID:22908272 mCherry is in the "even" or "0" reading frame starting from the exon. This is a Tol2-based FlExTrap vector. It consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon. Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pFT1.1
 
Resource Report
Resource Website
RRID:Addgene_46139 mCherry Ampicillin PMID:22908272 mCherry is in the "+1" reading frame starting from the exon. This is a Tol2-based FlExTrap vector. It consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon. Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pCasper4-tubulin-IVS-Syn21-QSco-p10
 
Resource Report
Resource Website
RRID:Addgene_46132 QSco Synthetic Ampicillin PMID:25581800 Please note that Addgene's sequencing results found a single nucleotide mismatch at bp# 5036 in the tubulin promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:11431; Vector Backbone:pCasper4-tubulinP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pAC-2-G4BDMD-QFAD
 
Resource Report
Resource Website
RRID:Addgene_46091 G4BDMD-QFAD Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pCaSpeR-act5cB-QF#7
 
Resource Report
Resource Website
RRID:Addgene_46125 QF#7 Synthetic Ampicillin PMID:25581800 Please note that Addgene's sequencing results found a few mismatches/gaps in the actin5c promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:11271; Vector Backbone:pCaSpeR-act5cB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pCaSpeR-act5cB-QF#7m1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46126 QF#7m1 Synthetic Ampicillin PMID:25581800 Please note that Addgene's sequencing results found a few mismatches/gaps in the actin5c promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:11271; Vector Backbone:pCaSpeR-act5cB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pattB-synaptobrevin-14-LEXA-QF-hsp70
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46123 LexA-QF Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pCaSpeR4-tubulin-QF#7m1
 
Resource Report
Resource Website
RRID:Addgene_46128 QF#7m1 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7743; Vector Backbone:pCaSpeR4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pDR-GFPuniv
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46085 DR-GFPuniv reporter Ampicillin PMID:22121229 Description: Plasmid for in vivo recombination assays. Based on the original pDR-GFP plasmid described in Pierce et al. GenDev (1999) v13p2633. Use data: Recipient plasmid for (homing) endonuclease target sites in order to assess in vivo activity of an endonuclease. The plasmid contains two non-functional copies of the eGFP gene: the 5’ copy is interrupted by the target site of interest and stop codons; the 3’ copy is truncated on both 5’- and 3’-end. pDR-GFP as is does not fulfill any other purpose than to receive (homing) endonuclease target sites. The recognition site for the endonuclease of interest must be cloned into the XhoI/SacI sites in the upstream eGFP gene, thus obliterating the XhoI, KpnI and SacI sites. Successful cleavage of the cloned target site generates a DSB. This triggers in vivo a homologous recombination event with the 3’ truncated copy of the eGFP which renders the 5’ copy functional. The activity of a given endonuclease can be measured by the number of GFP+ cells generated. The site that is cloned into pDR-GFP must insert a frameshift into the 5’ eGFP-copy and/or contain a stop codon in frame with the upstream sequence of the eGFP gene to assure that the ORF is not functional and no eGFP can be synthesized prior to the DSB repair event. In order to easily screen for the successful insertion of the oligonucleotide pair representing the site of interest, it is useful to integrate a restriction site that is not present in pDR-GFPuniv (e.g. a PvuII site). Sample oligonucleotide pair: oligo1 5’-TCGATAGGGATAACAGGGTAATACAGCTGTAAGCT-3’ oligo2 3’- ATCCCTATTGTCCCATTATGTCGACAT -5’ Please note that this plasmid functions as described in the associated publication and according to the depositing laboratory the changes to the EGFP sequence are not a concern. Backbone Marker:Jasin Lab (Addgene Plasmid# 26475); Vector Backbone:pDR-GFP; Vector Types:Mammalian Expression, recombination reporter plasmid; Bacterial Resistance:Ampicillin E5G and K163R mutations in EGFP relative to wild-type. EGFP truncated after amino acid 163 2026-08-15 01:15:29 3
pattB-synaptobrevin-12-QFBDAD-G4MD50-761-hsp70
 
Resource Report
Resource Website
RRID:Addgene_46121 QFBDAD-G4MD50-761 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pAC-QFrco
 
Resource Report
Resource Website
RRID:Addgene_46089 QFrco Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pattB-synaptobrevin-13-QFBDAD-G4MD257-761-hsp70
 
Resource Report
Resource Website
RRID:Addgene_46122 QFBDAD-G4MD257-761 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.