Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
LSB-hsa-miR-766-5p Resource Report Resource Website |
RRID:Addgene_103732 | hsa-miR-766-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:35 | 0 | |
|
LSB-hsa-miR-887-3p Resource Report Resource Website |
RRID:Addgene_103746 | hsa-miR-887-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:35 | 0 | |
|
LSB-hsa-miR-885-3p Resource Report Resource Website |
RRID:Addgene_103744 | hsa-miR-885-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:35 | 0 | |
|
LSB-hsa-miR-708-3p Resource Report Resource Website |
RRID:Addgene_103724 | hsa-miR-708-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:35 | 0 | |
|
LSB-hsa-miR-7-5p Resource Report Resource Website |
RRID:Addgene_103723 | hsa-miR-7-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:37 | 0 | |
|
pCR4-TOPO_L31-FLAG-TEV-AviTag_repair_template Resource Report Resource Website |
RRID:Addgene_235608 | Rpl31 C-terminus with FLAG-TEV-AviTag and flanking homology arms | Synthetic | Ampicillin and Kanamycin | PMID:40048539 | Backbone Marker:Invitrogen; Vector Backbone:pCR-4Blunt-TOPO; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:32:31 | 0 | ||
|
pTn Donor Resource Report Resource Website 1+ mentions |
RRID:Addgene_236211 | None | Ampicillin and Kanamycin | PMID:40148565 | Please visit https://doi.org/10.1101/2024.05.21.595064 for bioRxiv preprint. | Vector Backbone:R6K origin; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:32:31 | 1 | ||
|
pYJ01-Guide-SOX17-E1-gRNA1 Resource Report Resource Website |
RRID:Addgene_131046 | SOX17 Exon1 gRNA1 | Homo sapiens | Ampicillin and Kanamycin | Backbone Size:3979; Vector Backbone:pGuide-U6-gRNA; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:34:04 | 0 | |||
|
pcRII-mogat3a in situ probe Resource Report Resource Website |
RRID:Addgene_232135 | mogat3a | Danio rerio | Ampicillin and Kanamycin | PMID:39510175 | Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:31:47 | 0 | ||
|
pCRII-TOPO-mogat2 in situ probe Resource Report Resource Website |
RRID:Addgene_232139 | mogat2 | Danio rerio | Ampicillin and Kanamycin | PMID:39510175 | Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:31:47 | 0 | ||
|
pCRII-TOPO-dgat1b in situ probe Resource Report Resource Website |
RRID:Addgene_232138 | dgat1b | Danio rerio | Ampicillin and Kanamycin | PMID:39510175 | Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:31:47 | 0 | ||
|
pTA-attB Resource Report Resource Website 1+ mentions |
RRID:Addgene_18937 | phiC31 attB | Saccharomyces cerevisiae | Ampicillin and Kanamycin | PMID:10801973 | Backbone Marker:Invitrogen; Backbone Size:3805; Vector Backbone:pCR2.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:11:40 | 1 | ||
|
pSEVA12DKR-J Resource Report Resource Website |
RRID:Addgene_58306 | Genomic cassette | Synthetic | Ampicillin and Kanamycin | PMID:24847673 | Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:15 | 0 | ||
|
pSEVA12TEC-I Resource Report Resource Website |
RRID:Addgene_58308 | Genomic cassette | Synthetic | Ampicillin and Kanamycin | PMID:24847673 | Please note that Addgene's NGS found a 1209bp transposase insertion between the RepA and Epsilon Antitoxin sequence. The effect of this insertion is unknown. If you are interested in the version without the insertion, please contact the depositing lab (Tom Ellis lab). | Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:15 | 0 | |
|
pZmU3-gRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_53061 | zmU3 promoter - gRNA | maize (corn) | Ampicillin and Kanamycin | PMID:24576457 | Backbone Marker:Transgen; Backbone Size:3929; Vector Backbone:pEasy-blunt; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:16:31 | 1 | ||
|
pIKM1 Resource Report Resource Website |
RRID:Addgene_51054 | Ampicillin and Kanamycin | PMID:14766568 | For more information about this plasmid, see the associated publication (PMID: 14766568), as well as the publication describing its original construction: Mai, Lorenz, and Wiegel, Transformation of Thermoanaerobacterium sp. strain JW/SL-YS485 with plasmid pIKM1 conferring kanamycin resistance. FEMS Microbiol Lett. 1997 DOI: 10.1111/j.1574-6968.1997.tb10283.x ( http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6968.1997.tb10283.x/abstract ) | Backbone Marker:Mermelstein et al. 1992; Backbone Size:4500; Vector Backbone:pIMP1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:16:13 | 0 | |||
|
p2attNG-H11-short Resource Report Resource Website 1+ mentions |
RRID:Addgene_51546 | GFP4m | Ampicillin and Kanamycin | PMID:24304893 | Vector Backbone:p2attNG; Vector Types:Mammalian Expression, Human Targeting; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:16:14 | 1 | |||
|
mCherryS131C Resource Report Resource Website |
RRID:Addgene_48732 | mCherryS131C | Synthetic | Ampicillin and Kanamycin | PMID:21696135 | This plasmid must be grown under Ampicillin (100ug/ml) and Kanamycin (50ug/ml) selection in order to retain both the mCherryS131C plasmid and the pREP4 helper plasmid. Please note that verifying this plasmid by sequencing or digest is challenging due to the presence of the helper plasmid, as multiple bands or mispriming is likely to occur. See Addgene's sequencing results for recommended primers. The S131C mutation in this plasmid is S136C, when compared to the starting Met of wild-type mCherry. | Backbone Marker:QIAGEN; Backbone Size:3439; Vector Backbone:pQE-9; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | changed serine 131 to cysteine | 2026-08-15 01:15:53 | 0 |
|
pJC-lecg Resource Report Resource Website |
RRID:Addgene_239180 | lecg | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:35294875 | dsRNA can be generated by in vitro transcription with T7 RNA polymerase and single-stranded probes can be generated with SP6 or T3 RNA polymerases | Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:33:08 | 0 | |
|
Culex-027 Resource Report Resource Website |
RRID:Addgene_245842 | 16S rRNA | Culexarchaeum yellowstonense LCB-24-027 | Ampicillin and Kanamycin | PMID:41247030 | Vector Backbone:pcr2.1-oriT; Vector Types:Other; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:34:21 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.