Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pL106P-LUC-ENTR1A(w451-1) Resource Report Resource Website |
RRID:Addgene_17455 | FKBP-Luciferase fusion | firefly | Kanamycin | PMID:19657394 | Backbone Marker:Invitrogen; Backbone Size:2280; Vector Backbone:pENTR1A; Vector Types:Luciferase, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:41 | 0 | ||
|
pE2n Resource Report Resource Website |
RRID:Addgene_17456 | Kanamycin | PMID:18211686 | Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a N-terminal 3x HA tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU334817 | Backbone Marker:Invitrogen; Backbone Size:2427; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:41 | 0 | |||
|
pE3n Resource Report Resource Website 1+ mentions |
RRID:Addgene_17457 | Kanamycin | PMID:18211686 | Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a N-terminal 6x MYC tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU334818 | Backbone Marker:Invitrogen; Backbone Size:2595; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:41 | 1 | |||
|
pE5n Resource Report Resource Website |
RRID:Addgene_17459 | Kanamycin | PMID:18211686 | Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a N-terminal ECFP tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344820 | Backbone Marker:Invitrogen; Backbone Size:3030; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:42 | 0 | |||
|
pTK73_htz-1 Resource Report Resource Website |
RRID:Addgene_174546 | htz-1 targeting gRNA | Caenorhabditis elegans | Kanamycin | PMID:34865044 | Vector Backbone:pTK73; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:41 | 0 | ||
|
pFX-GalT-Venus Resource Report Resource Website |
RRID:Addgene_174472 | Venus with golgi apparatus-targeting sequence | Other | Kanamycin | PMID:31735740 | Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:40 | 0 | ||
|
pFX-Lifeact-Sirius Resource Report Resource Website |
RRID:Addgene_174475 | Sirius with actin-targeting sequence | Other | Kanamycin | PMID:31735740 | Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:40 | 0 | ||
|
pFX-Lifeact-EGFP Resource Report Resource Website |
RRID:Addgene_174477 | EGFP with actin-targeting sequence | Other | Kanamycin | PMID:31735740 | Backbone Size:4000; Vector Backbone:pFX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:40 | 0 | ||
|
pPGC-K Resource Report Resource Website |
RRID:Addgene_174581 | Kanamycin | Vector Backbone:pOPIN-A; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:41 | 0 | |||||
|
VPS29-YFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_174520 | VPS29 | Homo sapiens | Kanamycin | PMID:18981234 | Backbone Size:4700; Vector Backbone:YFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:41 | 1 | ||
|
6xHis-MBP-huMb3Cas12a Resource Report Resource Website |
RRID:Addgene_174677 | huMb3Cas12a | Moraxella bovoculi AAX11_00205 | Kanamycin | The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92293) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 | Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:43 | 0 | ||
|
6xHis-MBP-huBfCas12a Resource Report Resource Website 1+ mentions |
RRID:Addgene_174672 | huBfCas12a | Butyrivibrio fibrisolvens | Kanamycin | The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92301) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 | Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:42 | 1 | ||
|
6xHis-MBP-huMb2Cas12a Resource Report Resource Website 1+ mentions |
RRID:Addgene_174676 | huMb2Cas12a | Moraxella bovoculi AAX08_00205 | Kanamycin | The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92292) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 | Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:43 | 1 | ||
|
pENTR/pTER shEGFP #1 (628-2) Resource Report Resource Website 1+ mentions |
RRID:Addgene_17470 | Enhanced green fluorescent protein shRNA #1 | Kanamycin | PMID:19657394 | shRNA oligo sequence 5'-CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT | Backbone Marker:Invitrogen; Backbone Size:2555; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:43 | 1 | ||
|
pE6n Resource Report Resource Website |
RRID:Addgene_17460 | Kanamycin | PMID:18211686 | Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a N-terminal EYFP tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344821 | Backbone Marker:Invitrogen; Backbone Size:3030; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:42 | 0 | |||
|
pE2c Resource Report Resource Website |
RRID:Addgene_17462 | Kanamycin | PMID:18211686 | Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal 3x HA tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344823 | Backbone Marker:Invitrogen; Backbone Size:2426; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:42 | 0 | |||
|
pE4c Resource Report Resource Website |
RRID:Addgene_17464 | Kanamycin | PMID:18211686 | Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal GST tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344826 | Backbone Marker:Invitrogen; Backbone Size:2972; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:42 | 0 | |||
|
pE5c Resource Report Resource Website 1+ mentions |
RRID:Addgene_17465 | Kanamycin | PMID:18211686 | Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal ECFP tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344826 | Backbone Marker:Invitrogen; Backbone Size:3023; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:42 | 1 | |||
|
pETSXM2-pLacI-mtrCAB Resource Report Resource Website |
RRID:Addgene_174618 | mtrCAB | Synthetic | Kanamycin | Please note MtrC starts at amino acid 75. Depositor confirms this is not a concern. | Backbone Size:3903; Vector Backbone:pET-28a; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:42 | 0 | ||
|
6xHis-MBP-huPdCas12a Resource Report Resource Website |
RRID:Addgene_174682 | huPdCas12a | Prevotella disiens | Kanamycin | The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #69990) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 | Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:10:43 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
