Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Peft-3::cas9-SV40_NLS::tbb-2 3'UTR Resource Report Resource Website 10+ mentions |
RRID:Addgene_46168 | codon optimized Cas9_SV40 NLS with intron | Synthetic | Ampicillin | PMID:23817069 | Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | intron inserted at position 3113-3163, and SV40 NLS inserted from position 5192-5227 | 2026-08-15 01:15:29 | 47 |
|
pQUASp Resource Report Resource Website 1+ mentions |
RRID:Addgene_46162 | Ampicillin | PMID:27694947 | Backbone Size:9909; Vector Backbone:pUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 5 | ||||
|
pQUASp-mCD8mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_46164 | mCD8mCherry | Mus musculus | Ampicillin | Backbone Size:9929; Vector Backbone:pQUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 1 | |||
|
pJC-TALE-hairy Resource Report Resource Website |
RRID:Addgene_46145 | Ampicillin | PMID:23817068 | Backbone Marker:Gerry Rubin; Backbone Size:8151; Vector Backbone:pJFRC-7; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | ||||
|
pFT1.2 Resource Report Resource Website |
RRID:Addgene_46140 | mCherry | Ampicillin | PMID:22908272 | mCherry is in the "+2" reading frame starting from the exon. This is a Tol2-based FlExTrap vector. It consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon. | Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | ||
|
pT2-eab2-[GTR] Resource Report Resource Website |
RRID:Addgene_46144 | EGFP/mCherry | Ampicillin | PMID:19415631 | This plasmid can be used to make a transgene that expresses EGFP but can be switched to express mCherry if inverted. This reporter is controlled by a 2.3 kb regulatory sequence consisting of 0.2 kb Xenopus EF1alpha enhancer and 2.1 kb zebrafish beta-actin 2 sequence including the 1.5 kb enhancer/promoter sequence, the 1st exon (86 bp) and part of the 1st intron (490 bp). To generate a complete intron, the splice acceptor from the rabbit beta-globin gene was placed upstream of the EGFP reporter and a synthetic splice acceptor was placed upstream of the mCherry reporter. The synthetic splice acceptor contains the zebrafish consensus sequence along with intronic and exonic splice enhancers. There are some discrepancies between Addgene's and the depositor's sequence--these do not affect plasmid function. | Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, Tol2 zebrafish transgenic expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | ||
|
pPTQF#7-hsp70 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46136 | QF#7 | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:5176; Vector Backbone:pPTGAL4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 1 | |
|
pQUAST-GAL80 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46137 | GAL80 | Saccharomyces cerevisiae | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:8938; Vector Backbone:pQUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 1 | |
|
pFT1.0 Resource Report Resource Website |
RRID:Addgene_46138 | mCherry | Ampicillin | PMID:22908272 | mCherry is in the "even" or "0" reading frame starting from the exon. This is a Tol2-based FlExTrap vector. It consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon. | Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | ||
|
pFT1.1 Resource Report Resource Website |
RRID:Addgene_46139 | mCherry | Ampicillin | PMID:22908272 | mCherry is in the "+1" reading frame starting from the exon. This is a Tol2-based FlExTrap vector. It consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon. | Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | ||
|
pCasper4-tubulin-IVS-Syn21-QSco-p10 Resource Report Resource Website |
RRID:Addgene_46132 | QSco | Synthetic | Ampicillin | PMID:25581800 | Please note that Addgene's sequencing results found a single nucleotide mismatch at bp# 5036 in the tubulin promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:11431; Vector Backbone:pCasper4-tubulinP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | |
|
pAC-2-G4BDMD-QFAD Resource Report Resource Website |
RRID:Addgene_46091 | G4BDMD-QFAD | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | |
|
pCaSpeR-act5cB-QF#7 Resource Report Resource Website |
RRID:Addgene_46125 | QF#7 | Synthetic | Ampicillin | PMID:25581800 | Please note that Addgene's sequencing results found a few mismatches/gaps in the actin5c promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:11271; Vector Backbone:pCaSpeR-act5cB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | |
|
pCaSpeR-act5cB-QF#7m1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46126 | QF#7m1 | Synthetic | Ampicillin | PMID:25581800 | Please note that Addgene's sequencing results found a few mismatches/gaps in the actin5c promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:11271; Vector Backbone:pCaSpeR-act5cB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 1 | |
|
pattB-synaptobrevin-14-LEXA-QF-hsp70 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46123 | LexA-QF | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 1 | |
|
pCaSpeR4-tubulin-QF#7m1 Resource Report Resource Website |
RRID:Addgene_46128 | QF#7m1 | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:7743; Vector Backbone:pCaSpeR4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | |
|
pDR-GFPuniv Resource Report Resource Website 1+ mentions |
RRID:Addgene_46085 | DR-GFPuniv reporter | Ampicillin | PMID:22121229 | Description: Plasmid for in vivo recombination assays. Based on the original pDR-GFP plasmid described in Pierce et al. GenDev (1999) v13p2633. Use data: Recipient plasmid for (homing) endonuclease target sites in order to assess in vivo activity of an endonuclease. The plasmid contains two non-functional copies of the eGFP gene: the 5’ copy is interrupted by the target site of interest and stop codons; the 3’ copy is truncated on both 5’- and 3’-end. pDR-GFP as is does not fulfill any other purpose than to receive (homing) endonuclease target sites. The recognition site for the endonuclease of interest must be cloned into the XhoI/SacI sites in the upstream eGFP gene, thus obliterating the XhoI, KpnI and SacI sites. Successful cleavage of the cloned target site generates a DSB. This triggers in vivo a homologous recombination event with the 3’ truncated copy of the eGFP which renders the 5’ copy functional. The activity of a given endonuclease can be measured by the number of GFP+ cells generated. The site that is cloned into pDR-GFP must insert a frameshift into the 5’ eGFP-copy and/or contain a stop codon in frame with the upstream sequence of the eGFP gene to assure that the ORF is not functional and no eGFP can be synthesized prior to the DSB repair event. In order to easily screen for the successful insertion of the oligonucleotide pair representing the site of interest, it is useful to integrate a restriction site that is not present in pDR-GFPuniv (e.g. a PvuII site). Sample oligonucleotide pair: oligo1 5’-TCGATAGGGATAACAGGGTAATACAGCTGTAAGCT-3’ oligo2 3’- ATCCCTATTGTCCCATTATGTCGACAT -5’ Please note that this plasmid functions as described in the associated publication and according to the depositing laboratory the changes to the EGFP sequence are not a concern. | Backbone Marker:Jasin Lab (Addgene Plasmid# 26475); Vector Backbone:pDR-GFP; Vector Types:Mammalian Expression, recombination reporter plasmid; Bacterial Resistance:Ampicillin | E5G and K163R mutations in EGFP relative to wild-type. EGFP truncated after amino acid 163 | 2026-08-15 01:15:29 | 3 | |
|
pattB-synaptobrevin-12-QFBDAD-G4MD50-761-hsp70 Resource Report Resource Website |
RRID:Addgene_46121 | QFBDAD-G4MD50-761 | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | |
|
pAC-QFrco Resource Report Resource Website |
RRID:Addgene_46089 | QFrco | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | |
|
pattB-synaptobrevin-13-QFBDAD-G4MD257-761-hsp70 Resource Report Resource Website |
RRID:Addgene_46122 | QFBDAD-G4MD257-761 | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
