Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

33,857 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
6xHis-MBP-huErCas12a
 
Resource Report
Resource Website 		RRID:Addgene_174685 huErCas12a Eubacterium rectale Kanamycin The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Stephen Ekker Lab (Addgene #132641) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin Q926R mutation is observed as indicated from the lab the gene was obtained, but the mutation does not affect ErCas12a function 2026-08-15 01:10:43 0
6xHis-MBP-huPb2Cas12a
 
Resource Report
Resource Website 		RRID:Addgene_174686 huPb2Cas12a Prevotella bryantii B14 Kanamycin The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92272) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:10:43 0
6xHis-MBP-huTsCas12a
 
Resource Report
Resource Website 		RRID:Addgene_174687 huTsCas12a Thiomicrospira sp. XS5 Kanamycin The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92267) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:10:43 0
pET28-FnCas12a-TEV
 
Resource Report
Resource Website 		RRID:Addgene_174658 FnCas12a Francisella novicida Kanamycin PMID:33608525 Vector Backbone:pET28; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:10:42 0
pET28_6xHis-PARP1-K893I
 
Resource Report
Resource Website 		RRID:Addgene_174799 PARP1-K893I Homo sapiens Kanamycin PMID:34465625 Protein residues 1-1014 (V762A, K893I) (see PMID: 8473297 for detail about the mutation) Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin K893I, V762A 2026-08-15 01:10:44 0
pET28_6xHis-PARP1-W318R
 
Resource Report
Resource Website 		RRID:Addgene_174793 PARP1-W318R Homo sapiens Kanamycin PMID:34465625 Protein residues 1-1014 (W318R, V762A) (see PMID: 26626480 for detail about the mutation) Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin W318, V762A 2026-08-15 01:10:44 0
pET28_6xHis-PARP1-A762V
 
Resource Report
Resource Website 		RRID:Addgene_174795 PARP1-A762V Homo sapiens Kanamycin PMID:34465625 Protein residues 1-1014 (see PMID: 20399804 for detail about the mutation) Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin A762V 2026-08-15 01:10:44 0
pET28_6xHis-PARP1-A774L
 
Resource Report
Resource Website 		RRID:Addgene_174796 PARP1-A774L Homo sapiens Kanamycin PMID:34465625 Protein residues 1-1014 (V762A, A774L) (*protein expression may be toxic to host, add 10 mM benzamide to all growth media, see PMID: 28695525 for protocol) (see PMID: 26626480 for detail about the mutation) Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin A774L, V762A 2026-08-15 01:10:44 0
pET28_6xHis-PARP1-A870L
 
Resource Report
Resource Website 		RRID:Addgene_174797 PARP1-A870L Homo sapiens Kanamycin PMID:34465625 Protein residues 1-1014 (V762A, A870L) (*protein expression may be toxic to host, add 10 mM benzamide to all growth media, see PMID: 28695525 for protocol) (see PMID: 26626480 for detail about the mutation) Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin A870L, V762A 2026-08-15 01:10:44 0
pZA72
 
Resource Report
Resource Website 		RRID:Addgene_174783 GG_XopJ4, Kmr plant selection marker X. perforans Kanamycin PMID:34633454 Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin WT + STOP codon 2026-08-15 01:10:44 0
pZA71
 
Resource Report
Resource Website 		RRID:Addgene_174785 GG_synthesized NbJIM2 (NbJIM2syn)-3xFLAG, Kmr plant selection marker N. benthamiana Kanamycin PMID:34633454 Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin WT 2026-08-15 01:10:44 0
pZA64
 
Resource Report
Resource Website 		RRID:Addgene_174777 GG_NbZAR1syn-L17E/D481V-6xHA, Kmr plant selection marker N. benthamiana Kanamycin PMID:34633454 Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin L17E/D481V 2026-08-15 01:10:44 0
pZA65
 
Resource Report
Resource Website 		RRID:Addgene_174778 GG_NbZAR1syn-eGFP, Kmr plant selection marker N. benthamiana Kanamycin PMID:34633454 Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin WT 2026-08-15 01:10:44 0
pET41sIII_GST-ALC1-K77R
 
Resource Report
Resource Website 		RRID:Addgene_174813 ALC1-K77R Homo sapiens Kanamycin PMID:34465625 Protein residues 1-897 (a start codon included in-frame) Please note: Plasmid contains R25P and S743C natural variants in ALC1. Vector Backbone:pET41; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin K77R 2026-08-15 01:10:44 0
pET41sIII_GST-ALC1-E175Q
 
Resource Report
Resource Website 		RRID:Addgene_174814 ALC1-E175Q Homo sapiens Kanamycin PMID:34465625 Protein residues 1-897 (a start codon included in-frame). Please note: Plasmid contains R25P and S743C natural variants in ALC1. Vector Backbone:pET41; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin E175Q 2026-08-15 01:10:44 0
pENTR/pTER shEGFP #2 (728-2)
 
Resource Report
Resource Website 		RRID:Addgene_17471 Enhanced green fluorescent protein shRNA #2 Kanamycin PMID:19657394 shRNA sequence is- 5'-CCGCTGGAGTACAACTACAACTTCAAGAGAGTTGTAGTTGTACTCCAGCTTTTT Backbone Marker:Invitrogen; Backbone Size:2556; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:10:43 0
pENTR-LUC (w158-1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_17473 Firefly Luciferase Kanamycin PMID:19657394 Backbone Marker:Invitrogen; Backbone Size:2240; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:10:43 5
pZA59
 
Resource Report
Resource Website 		RRID:Addgene_174772 GG_NbZAR1syn-L17E-4xMyc, Kmr plant selection marker N. benthamiana Kanamycin PMID:34633454 Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin L17E 2026-08-15 01:10:43 0
pZA60
 
Resource Report
Resource Website 		RRID:Addgene_174773 GG_NbZAR1syn-L17E/D481V-4xMyc, Kmr plant selection marker N. benthamiana Kanamycin PMID:34633454 Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin L17E/D481V 2026-08-15 01:10:43 0
pZA61
 
Resource Report
Resource Website 		RRID:Addgene_174774 GG_NbZAR1syn-6xHA, Kmr plant selection marker N. benthamiana Kanamycin PMID:34633454 Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin WT 2026-08-15 01:10:43 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch