Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBactin-PACT-mOrange2-hCM1 Resource Report Resource Website |
RRID:Addgene_196868 | PACT-mOrange2-hCM1 | Rattus norvegicus | Ampicillin | PMID:36796357 | Backbone Size:6972; Vector Backbone:pBeta-actin-Nedd1-mOrange2-hCM1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:26:30 | 0 | ||
|
pCR-XL-rAkap9 Resource Report Resource Website |
RRID:Addgene_196867 | Akap9 | Rattus norvegicus | Kanamycin | PMID:36796357 | For successful transformation of Plasmid 196867: pCR-XL-rAkap9, it is recommended to use electroporation and to grow transformed bacteria at no more than 28 °C for two days and with 30 μg/ml kanamycin on LB plates for full length plasmid production | Backbone Size:3519; Vector Backbone:pCR-XL-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:26:28 | 0 | |
|
pBactin-Nedd1-mOrange2-rCM1 Resource Report Resource Website |
RRID:Addgene_196861 | Nedd1-mOrange2-rCM1 | Rattus norvegicus | Ampicillin | PMID:36796357 | Backbone Size:8089; Vector Backbone:pBeta-actin-Nedd1-mOrange2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:26:30 | 0 | ||
|
pBactin-Nedd1-mOrange2 Resource Report Resource Website |
RRID:Addgene_196860 | Nedd1-mOrange2 | Rattus norvegicus | Ampicillin | PMID:36796357 | Backbone Size:6040; Vector Backbone:pBeta-actin-Tubg1-mEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:26:29 | 0 | ||
|
pBactin-Nedd1-mOrange2-F75A Resource Report Resource Website |
RRID:Addgene_196862 | Nedd1-mOrange2-F75A | Rattus norvegicus | Ampicillin | PMID:36796357 | Backbone Size:8089; Vector Backbone:pBeta-actin-Nedd1-mOrange2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | F75A in the CM1 domain | 2026-08-15 01:26:28 | 0 | |
|
pBactin-AcGFP-128-425-Akap9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_196871 | AcGFP-Akap9 (128-425) | Rattus norvegicus | Ampicillin | PMID:36796357 | Backbone Size:6000; Vector Backbone:pBeta-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:26:30 | 1 | ||
|
pCI pHluorin Syt4 Resource Report Resource Website |
RRID:Addgene_184505 | Synaptotagmin 4 | Rattus norvegicus | Ampicillin | PMID:22398727 | The first codon of the Synpatotagmin has been removed | Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:26:28 | 0 | |
|
pBactin-td-mCherry-Cdk5rap2 Resource Report Resource Website |
RRID:Addgene_196859 | td-mCherry-Cdk5rap2 | Rattus norvegicus | Ampicillin | PMID:36796357 | Backbone Size:7437; Vector Backbone:pBeta-actin-td-mCherry-CI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:26:28 | 0 | ||
|
pBactin-AcGFP-Cdk5rap2-CTD Resource Report Resource Website |
RRID:Addgene_196853 | AcGFP-Cdk5rap2-CTD | Rattus norvegicus | Ampicillin | PMID:36796357 | Backbone Size:6748; Vector Backbone:pBeta-actin-AcGFP-CI ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | None (wt) | 2026-08-15 01:26:30 | 0 | |
|
pDS170-enNTS1 Resource Report Resource Website |
RRID:Addgene_199152 | enNTS1 | Rattus norvegicus | Ampicillin | PMID:36680775 | For additional information, please refer to: Bumbak et al. 2018 "Optimization and 13CH3 methionine labeling of a signaling competent neurotensin receptor 1 variant for NMR studies" BBA Biomembranes. https://doi.org/10.1016/j.bbamem.2018.03.020 Bumbak et al. 2019 "Expression and Purification of a Functional E. coli 13CH3-Methionine-Labeled Thermostable Neurotensin Receptor 1 Variant for Solution NMR Studies" Methods Mol Biol. https://doi.org/10.1007/978-1-4939-9121-1_3 | Backbone Marker:Internal Lab Plasmid; Backbone Size:6112; Vector Backbone:pDS170; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | V208M, C273S, C391S and C393S (over NTS1-B5) | 2026-08-15 01:26:31 | 0 |
|
PGK mScarlet-LC3B Resource Report Resource Website 1+ mentions |
RRID:Addgene_200083 | Map1lc3b | Rattus norvegicus | Kanamycin | PMID:37133994 | Backbone Marker:Clontech; Backbone Size:3900; Vector Backbone:pEGFPc/PGK; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:26:32 | 1 | ||
|
Shank3-HA/pRK5 Resource Report Resource Website |
RRID:Addgene_197335 | Shank3 | Rattus norvegicus | Ampicillin | This is a validated antigen plasmid of Anti-Shank3 [N69/46R]. | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:26:47 | 0 | ||
|
pZac2.1 gfaABC1D-BioID2-BioID2-Kir4.1-HA Resource Report Resource Website |
RRID:Addgene_176746 | HA-BioID2-BioID2-Kir4.1 | Rattus norvegicus | Ampicillin | PMID:37046092 | Backbone Marker:Khakh lab; Backbone Size:5110; Vector Backbone:PZac2.1; Vector Types:Bacterial Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:26:08 | 0 | ||
|
pACT2-μ3A Resource Report Resource Website |
RRID:Addgene_198174 | AP-3 μ3A | Rattus norvegicus | Ampicillin | PMID:24229647 | Backbone Size:8117; Vector Backbone:pACT2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | silent substitution in codon 225 | 2026-08-15 01:26:10 | 0 | |
|
pCI-neo-μ3A-(HA)3 Resource Report Resource Website |
RRID:Addgene_198179 | AP-3 μ3A | Rattus norvegicus | Ampicillin | PMID:24831812 | μ3A + linker + HA tag subcloned between EcoRI and SalI sites; double HA tag subcloned between SalI and NotI sites (SalI site destroyed) | Backbone Size:5474; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | silent substitution in codon 225 | 2026-08-15 01:26:10 | 0 |
|
NF-155 pcDNA3 Resource Report Resource Website |
RRID:Addgene_197290 | Pan-Neurofascin (extracellular) | Rattus norvegicus | Ampicillin | PMID:9562181 | This is a validated antigen plasmid of Anti-Pan-Neurofascin (extracellular) [A12/18R]. Additional reference: https://pubmed.ncbi.nlm.nih.gov/10931875/. | Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:26:13 | 0 | |
|
pGL3-MTS-ND6-W82-L15-G1333N-UGI-Puro Resource Report Resource Website |
RRID:Addgene_198860 | ND6-W82-L15 TALEN | Rattus norvegicus | Ampicillin | PMID:37058569 | These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG | Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:26:17 | 0 | |
|
pEN_TT mCh-V5-NES-EGFP-Erbb2 NLS Resource Report Resource Website |
RRID:Addgene_192317 | mCh-V5-NES-EGFP-Erbb2 NLS | Rattus norvegicus | Gentamicin | PMID:37055441 | Backbone Marker:Addgene #25752; Vector Backbone:pEN_TTmiRC2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:26:17 | 0 | ||
|
pSLIK mCh-V5-NES-EGFP-Erbb2 NLS zeo Resource Report Resource Website |
RRID:Addgene_192339 | mCh-V5-NES-EGFP-Erbb2 NLS | Rattus norvegicus | Ampicillin | PMID:37055441 | Backbone Marker:Addgene #25736; Vector Backbone:pSLIK zeo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:26:19 | 0 | ||
|
mTq2-Calmodulin Resource Report Resource Website 1+ mentions |
RRID:Addgene_198200 | Calmodulin 2 | Rattus norvegicus | Ampicillin | PMID:37516972 | Backbone Size:5335; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:27:04 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
